ID: 1091353169

View in Genome Browser
Species Human (GRCh38)
Location 11:134913860-134913882
Sequence TAAACAGCAGGCGACTCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091353164_1091353169 8 Left 1091353164 11:134913829-134913851 CCTGAGGGCTGGTGCAGTGGCAG No data
Right 1091353169 11:134913860-134913882 TAAACAGCAGGCGACTCTGTGGG No data
1091353162_1091353169 15 Left 1091353162 11:134913822-134913844 CCACAGTCCTGAGGGCTGGTGCA No data
Right 1091353169 11:134913860-134913882 TAAACAGCAGGCGACTCTGTGGG No data
1091353161_1091353169 16 Left 1091353161 11:134913821-134913843 CCCACAGTCCTGAGGGCTGGTGC No data
Right 1091353169 11:134913860-134913882 TAAACAGCAGGCGACTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091353169 Original CRISPR TAAACAGCAGGCGACTCTGT GGG Intergenic