ID: 1091354294

View in Genome Browser
Species Human (GRCh38)
Location 11:134923793-134923815
Sequence CCCGGGGATGTTCCCTCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091354286_1091354294 4 Left 1091354286 11:134923766-134923788 CCCAGTACTCAGAGGGAGGCCGT No data
Right 1091354294 11:134923793-134923815 CCCGGGGATGTTCCCTCAGTAGG No data
1091354278_1091354294 29 Left 1091354278 11:134923741-134923763 CCTTCTTACCTGCCTCTTTCCTA No data
Right 1091354294 11:134923793-134923815 CCCGGGGATGTTCCCTCAGTAGG No data
1091354285_1091354294 5 Left 1091354285 11:134923765-134923787 CCCCAGTACTCAGAGGGAGGCCG No data
Right 1091354294 11:134923793-134923815 CCCGGGGATGTTCCCTCAGTAGG No data
1091354280_1091354294 17 Left 1091354280 11:134923753-134923775 CCTCTTTCCTATCCCCAGTACTC No data
Right 1091354294 11:134923793-134923815 CCCGGGGATGTTCCCTCAGTAGG No data
1091354279_1091354294 21 Left 1091354279 11:134923749-134923771 CCTGCCTCTTTCCTATCCCCAGT No data
Right 1091354294 11:134923793-134923815 CCCGGGGATGTTCCCTCAGTAGG No data
1091354283_1091354294 10 Left 1091354283 11:134923760-134923782 CCTATCCCCAGTACTCAGAGGGA No data
Right 1091354294 11:134923793-134923815 CCCGGGGATGTTCCCTCAGTAGG No data
1091354287_1091354294 3 Left 1091354287 11:134923767-134923789 CCAGTACTCAGAGGGAGGCCGTG No data
Right 1091354294 11:134923793-134923815 CCCGGGGATGTTCCCTCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091354294 Original CRISPR CCCGGGGATGTTCCCTCAGT AGG Intergenic
No off target data available for this crispr