ID: 1091356624

View in Genome Browser
Species Human (GRCh38)
Location 11:134942411-134942433
Sequence AGTCCTACGCCCCTGCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091356624_1091356631 4 Left 1091356624 11:134942411-134942433 CCTCCCAGCAGGGGCGTAGGACT No data
Right 1091356631 11:134942438-134942460 TGAGGAGGGGCGCGAGTGCGCGG No data
1091356624_1091356630 -9 Left 1091356624 11:134942411-134942433 CCTCCCAGCAGGGGCGTAGGACT No data
Right 1091356630 11:134942425-134942447 CGTAGGACTAGAGTGAGGAGGGG No data
1091356624_1091356629 -10 Left 1091356624 11:134942411-134942433 CCTCCCAGCAGGGGCGTAGGACT No data
Right 1091356629 11:134942424-134942446 GCGTAGGACTAGAGTGAGGAGGG No data
1091356624_1091356632 22 Left 1091356624 11:134942411-134942433 CCTCCCAGCAGGGGCGTAGGACT No data
Right 1091356632 11:134942456-134942478 CGCGGCCCACAGAAGAGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091356624 Original CRISPR AGTCCTACGCCCCTGCTGGG AGG (reversed) Intergenic
No off target data available for this crispr