ID: 1091367250

View in Genome Browser
Species Human (GRCh38)
Location 11:135032631-135032653
Sequence CAAATTTGACCGTGTTACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091367245_1091367250 18 Left 1091367245 11:135032590-135032612 CCTGCCCTCTGTATGATATCCAA No data
Right 1091367250 11:135032631-135032653 CAAATTTGACCGTGTTACCCTGG No data
1091367246_1091367250 14 Left 1091367246 11:135032594-135032616 CCCTCTGTATGATATCCAACTGG No data
Right 1091367250 11:135032631-135032653 CAAATTTGACCGTGTTACCCTGG No data
1091367248_1091367250 13 Left 1091367248 11:135032595-135032617 CCTCTGTATGATATCCAACTGGA No data
Right 1091367250 11:135032631-135032653 CAAATTTGACCGTGTTACCCTGG No data
1091367249_1091367250 -1 Left 1091367249 11:135032609-135032631 CCAACTGGATCTCACTGAAATGC No data
Right 1091367250 11:135032631-135032653 CAAATTTGACCGTGTTACCCTGG No data
1091367244_1091367250 27 Left 1091367244 11:135032581-135032603 CCACATGAGCCTGCCCTCTGTAT No data
Right 1091367250 11:135032631-135032653 CAAATTTGACCGTGTTACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091367250 Original CRISPR CAAATTTGACCGTGTTACCC TGG Intergenic
No off target data available for this crispr