ID: 1091372310

View in Genome Browser
Species Human (GRCh38)
Location 11:135071052-135071074
Sequence CACAGATGACAGATAAGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091372306_1091372310 6 Left 1091372306 11:135071023-135071045 CCATTTGATCCTCCCAGTGAGGC No data
Right 1091372310 11:135071052-135071074 CACAGATGACAGATAAGCCATGG No data
1091372309_1091372310 -7 Left 1091372309 11:135071036-135071058 CCAGTGAGGCTACACACACAGAT No data
Right 1091372310 11:135071052-135071074 CACAGATGACAGATAAGCCATGG No data
1091372307_1091372310 -3 Left 1091372307 11:135071032-135071054 CCTCCCAGTGAGGCTACACACAC No data
Right 1091372310 11:135071052-135071074 CACAGATGACAGATAAGCCATGG No data
1091372308_1091372310 -6 Left 1091372308 11:135071035-135071057 CCCAGTGAGGCTACACACACAGA No data
Right 1091372310 11:135071052-135071074 CACAGATGACAGATAAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091372310 Original CRISPR CACAGATGACAGATAAGCCA TGG Intergenic
No off target data available for this crispr