ID: 1091373273

View in Genome Browser
Species Human (GRCh38)
Location 12:10690-10712
Sequence AGACCCGGAGAGCACCGCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091373273_1091373276 4 Left 1091373273 12:10690-10712 CCCTCGCGGTGCTCTCCGGGTCT No data
Right 1091373276 12:10717-10739 TGAAGAGAACGCAACTCCGCCGG No data
1091373273_1091373277 10 Left 1091373273 12:10690-10712 CCCTCGCGGTGCTCTCCGGGTCT No data
Right 1091373277 12:10723-10745 GAACGCAACTCCGCCGGCGCAGG No data
1091373273_1091373279 20 Left 1091373273 12:10690-10712 CCCTCGCGGTGCTCTCCGGGTCT No data
Right 1091373279 12:10733-10755 CCGCCGGCGCAGGCGCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091373273 Original CRISPR AGACCCGGAGAGCACCGCGA GGG (reversed) Intergenic
No off target data available for this crispr