ID: 1091373274

View in Genome Browser
Species Human (GRCh38)
Location 12:10691-10713
Sequence CAGACCCGGAGAGCACCGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091373274_1091373279 19 Left 1091373274 12:10691-10713 CCTCGCGGTGCTCTCCGGGTCTG No data
Right 1091373279 12:10733-10755 CCGCCGGCGCAGGCGCAGAGAGG No data
1091373274_1091373277 9 Left 1091373274 12:10691-10713 CCTCGCGGTGCTCTCCGGGTCTG No data
Right 1091373277 12:10723-10745 GAACGCAACTCCGCCGGCGCAGG No data
1091373274_1091373276 3 Left 1091373274 12:10691-10713 CCTCGCGGTGCTCTCCGGGTCTG No data
Right 1091373276 12:10717-10739 TGAAGAGAACGCAACTCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091373274 Original CRISPR CAGACCCGGAGAGCACCGCG AGG (reversed) Intergenic
No off target data available for this crispr