ID: 1091373276

View in Genome Browser
Species Human (GRCh38)
Location 12:10717-10739
Sequence TGAAGAGAACGCAACTCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091373274_1091373276 3 Left 1091373274 12:10691-10713 CCTCGCGGTGCTCTCCGGGTCTG No data
Right 1091373276 12:10717-10739 TGAAGAGAACGCAACTCCGCCGG No data
1091373271_1091373276 7 Left 1091373271 12:10687-10709 CCGCCCTCGCGGTGCTCTCCGGG No data
Right 1091373276 12:10717-10739 TGAAGAGAACGCAACTCCGCCGG No data
1091373273_1091373276 4 Left 1091373273 12:10690-10712 CCCTCGCGGTGCTCTCCGGGTCT No data
Right 1091373276 12:10717-10739 TGAAGAGAACGCAACTCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091373276 Original CRISPR TGAAGAGAACGCAACTCCGC CGG Intergenic
No off target data available for this crispr