ID: 1091374753

View in Genome Browser
Species Human (GRCh38)
Location 12:18067-18089
Sequence CTTGCTCTGGATCCTGTGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091374740_1091374753 16 Left 1091374740 12:18028-18050 CCAGCAGACCTGCAGGGCCCGCT No data
Right 1091374753 12:18067-18089 CTTGCTCTGGATCCTGTGGCGGG No data
1091374748_1091374753 -2 Left 1091374748 12:18046-18068 CCGCTCGTCCAGGGGGCGGTGCT No data
Right 1091374753 12:18067-18089 CTTGCTCTGGATCCTGTGGCGGG No data
1091374747_1091374753 -1 Left 1091374747 12:18045-18067 CCCGCTCGTCCAGGGGGCGGTGC No data
Right 1091374753 12:18067-18089 CTTGCTCTGGATCCTGTGGCGGG No data
1091374741_1091374753 8 Left 1091374741 12:18036-18058 CCTGCAGGGCCCGCTCGTCCAGG No data
Right 1091374753 12:18067-18089 CTTGCTCTGGATCCTGTGGCGGG No data
1091374749_1091374753 -10 Left 1091374749 12:18054-18076 CCAGGGGGCGGTGCTTGCTCTGG No data
Right 1091374753 12:18067-18089 CTTGCTCTGGATCCTGTGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091374753 Original CRISPR CTTGCTCTGGATCCTGTGGC GGG Intergenic
No off target data available for this crispr