ID: 1091375758

View in Genome Browser
Species Human (GRCh38)
Location 12:23668-23690
Sequence TTGTGTCCCCACGGTGCCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091375758_1091375765 17 Left 1091375758 12:23668-23690 CCCGTGGCACCGTGGGGACACAA No data
Right 1091375765 12:23708-23730 TCCCTCAGCCCCATTCAAAGAGG No data
1091375758_1091375772 30 Left 1091375758 12:23668-23690 CCCGTGGCACCGTGGGGACACAA No data
Right 1091375772 12:23721-23743 TTCAAAGAGGCCTGGCCCACAGG No data
1091375758_1091375768 22 Left 1091375758 12:23668-23690 CCCGTGGCACCGTGGGGACACAA No data
Right 1091375768 12:23713-23735 CAGCCCCATTCAAAGAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091375758 Original CRISPR TTGTGTCCCCACGGTGCCAC GGG (reversed) Intergenic
No off target data available for this crispr