ID: 1091376470

View in Genome Browser
Species Human (GRCh38)
Location 12:27616-27638
Sequence ACTCCTGGAATTGCACAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091376467_1091376470 8 Left 1091376467 12:27585-27607 CCTGTGGGGGTGGAGGACAGGAA No data
Right 1091376470 12:27616-27638 ACTCCTGGAATTGCACAGTGAGG No data
1091376459_1091376470 25 Left 1091376459 12:27568-27590 CCAAGAGGAAAGAGGTGCCTGTG No data
Right 1091376470 12:27616-27638 ACTCCTGGAATTGCACAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091376470 Original CRISPR ACTCCTGGAATTGCACAGTG AGG Intergenic
No off target data available for this crispr