ID: 1091377012

View in Genome Browser
Species Human (GRCh38)
Location 12:31484-31506
Sequence AGGGCGCAGCGGAGGGCGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091377012_1091377023 11 Left 1091377012 12:31484-31506 CCGCTCGCCCTCCGCTGCGCCCT No data
Right 1091377023 12:31518-31540 GCTCCAGGACCCCGTCGACCCGG No data
1091377012_1091377029 28 Left 1091377012 12:31484-31506 CCGCTCGCCCTCCGCTGCGCCCT No data
Right 1091377029 12:31535-31557 ACCCGGAGCGCTGTCCTGTCGGG No data
1091377012_1091377018 -4 Left 1091377012 12:31484-31506 CCGCTCGCCCTCCGCTGCGCCCT No data
Right 1091377018 12:31503-31525 CCCTCCCCGAGCGCGGCTCCAGG No data
1091377012_1091377028 27 Left 1091377012 12:31484-31506 CCGCTCGCCCTCCGCTGCGCCCT No data
Right 1091377028 12:31534-31556 GACCCGGAGCGCTGTCCTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091377012 Original CRISPR AGGGCGCAGCGGAGGGCGAG CGG (reversed) Intergenic
No off target data available for this crispr