ID: 1091377362

View in Genome Browser
Species Human (GRCh38)
Location 12:33867-33889
Sequence ACCACATCATATACCAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091377361_1091377362 -4 Left 1091377361 12:33848-33870 CCTGTGAATATACACACACACCA No data
Right 1091377362 12:33867-33889 ACCACATCATATACCAAGCCTGG No data
1091377360_1091377362 4 Left 1091377360 12:33840-33862 CCACGATGCCTGTGAATATACAC No data
Right 1091377362 12:33867-33889 ACCACATCATATACCAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091377362 Original CRISPR ACCACATCATATACCAAGCC TGG Intergenic
No off target data available for this crispr