ID: 1091377404

View in Genome Browser
Species Human (GRCh38)
Location 12:34128-34150
Sequence CCCAGCTGGCCAGCAAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091377404_1091377416 13 Left 1091377404 12:34128-34150 CCTGCCTTTGCTGGCCAGCTGGG No data
Right 1091377416 12:34164-34186 GGAAATTAAGGCTGCAGGGTTGG No data
1091377404_1091377413 8 Left 1091377404 12:34128-34150 CCTGCCTTTGCTGGCCAGCTGGG No data
Right 1091377413 12:34159-34181 GCCTGGGAAATTAAGGCTGCAGG No data
1091377404_1091377410 -9 Left 1091377404 12:34128-34150 CCTGCCTTTGCTGGCCAGCTGGG No data
Right 1091377410 12:34142-34164 CCAGCTGGGCTGAGTGGGCCTGG No data
1091377404_1091377417 20 Left 1091377404 12:34128-34150 CCTGCCTTTGCTGGCCAGCTGGG No data
Right 1091377417 12:34171-34193 AAGGCTGCAGGGTTGGTCCCAGG No data
1091377404_1091377411 -8 Left 1091377404 12:34128-34150 CCTGCCTTTGCTGGCCAGCTGGG No data
Right 1091377411 12:34143-34165 CAGCTGGGCTGAGTGGGCCTGGG No data
1091377404_1091377412 1 Left 1091377404 12:34128-34150 CCTGCCTTTGCTGGCCAGCTGGG No data
Right 1091377412 12:34152-34174 TGAGTGGGCCTGGGAAATTAAGG No data
1091377404_1091377415 9 Left 1091377404 12:34128-34150 CCTGCCTTTGCTGGCCAGCTGGG No data
Right 1091377415 12:34160-34182 CCTGGGAAATTAAGGCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091377404 Original CRISPR CCCAGCTGGCCAGCAAAGGC AGG (reversed) Intergenic
No off target data available for this crispr