ID: 1091377417

View in Genome Browser
Species Human (GRCh38)
Location 12:34171-34193
Sequence AAGGCTGCAGGGTTGGTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091377401_1091377417 25 Left 1091377401 12:34123-34145 CCCTGCCTGCCTTTGCTGGCCAG No data
Right 1091377417 12:34171-34193 AAGGCTGCAGGGTTGGTCCCAGG No data
1091377404_1091377417 20 Left 1091377404 12:34128-34150 CCTGCCTTTGCTGGCCAGCTGGG No data
Right 1091377417 12:34171-34193 AAGGCTGCAGGGTTGGTCCCAGG No data
1091377402_1091377417 24 Left 1091377402 12:34124-34146 CCTGCCTGCCTTTGCTGGCCAGC No data
Right 1091377417 12:34171-34193 AAGGCTGCAGGGTTGGTCCCAGG No data
1091377406_1091377417 16 Left 1091377406 12:34132-34154 CCTTTGCTGGCCAGCTGGGCTGA No data
Right 1091377417 12:34171-34193 AAGGCTGCAGGGTTGGTCCCAGG No data
1091377409_1091377417 6 Left 1091377409 12:34142-34164 CCAGCTGGGCTGAGTGGGCCTGG No data
Right 1091377417 12:34171-34193 AAGGCTGCAGGGTTGGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091377417 Original CRISPR AAGGCTGCAGGGTTGGTCCC AGG Intergenic
No off target data available for this crispr