ID: 1091378231

View in Genome Browser
Species Human (GRCh38)
Location 12:40012-40034
Sequence TAGCCAGGAGTCTCATCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091378225_1091378231 13 Left 1091378225 12:39976-39998 CCTGAGTAAAGTTGAAGGGGAGG No data
Right 1091378231 12:40012-40034 TAGCCAGGAGTCTCATCCCCTGG No data
1091378221_1091378231 19 Left 1091378221 12:39970-39992 CCAGGTCCTGAGTAAAGTTGAAG No data
Right 1091378231 12:40012-40034 TAGCCAGGAGTCTCATCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091378231 Original CRISPR TAGCCAGGAGTCTCATCCCC TGG Intergenic
No off target data available for this crispr