ID: 1091379016

View in Genome Browser
Species Human (GRCh38)
Location 12:43733-43755
Sequence CTCCTTCATAAGCAAGCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091379016_1091379019 26 Left 1091379016 12:43733-43755 CCTGTGGCTTGCTTATGAAGGAG No data
Right 1091379019 12:43782-43804 ATCATATTGTATAAGATCACTGG No data
1091379016_1091379020 30 Left 1091379016 12:43733-43755 CCTGTGGCTTGCTTATGAAGGAG No data
Right 1091379020 12:43786-43808 TATTGTATAAGATCACTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091379016 Original CRISPR CTCCTTCATAAGCAAGCCAC AGG (reversed) Intergenic
No off target data available for this crispr