ID: 1091383143

View in Genome Browser
Species Human (GRCh38)
Location 12:75948-75970
Sequence TCGGTTCTGTTTATTGCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 2, 1: 0, 2: 0, 3: 1, 4: 36}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091383143_1091383151 1 Left 1091383143 12:75948-75970 CCCCCGGCAATAAACAGAACCGA 0: 2
1: 0
2: 0
3: 1
4: 36
Right 1091383151 12:75972-75994 CCCAATCCTAGCTATGAGCAGGG 0: 2
1: 0
2: 0
3: 9
4: 92
1091383143_1091383149 0 Left 1091383143 12:75948-75970 CCCCCGGCAATAAACAGAACCGA 0: 2
1: 0
2: 0
3: 1
4: 36
Right 1091383149 12:75971-75993 CCCCAATCCTAGCTATGAGCAGG 0: 2
1: 0
2: 0
3: 6
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091383143 Original CRISPR TCGGTTCTGTTTATTGCCGG GGG (reversed) Intronic
905204353 1:36334530-36334552 TCTGTTATGTTTCTTGGCGGAGG - Intergenic
907999195 1:59664162-59664184 TCGGTTCTGTACATTCCCAGTGG + Intronic
1063058889 10:2530396-2530418 TCGGTTCTGTTTCTCTCTGGTGG - Intergenic
1081227471 11:40541882-40541904 TCAGTTCTGTTTATAGAAGGAGG - Intronic
1083622495 11:64056111-64056133 CCGGGGCTGCTTATTGCCGGGGG - Intronic
1086911559 11:92478579-92478601 TCGTTTCTGTTTATCTCAGGAGG - Intronic
1087355928 11:97094503-97094525 TGGTGTCTGTTTATTGCCTGAGG + Intergenic
1091383143 12:75948-75970 TCGGTTCTGTTTATTGCCGGGGG - Intronic
1095451457 12:42335546-42335568 TCGTTTCTGTTTTTTGCTGTAGG + Intronic
1112380852 13:98888223-98888245 TCTGTTTTGTTTATTGCTGCAGG - Exonic
1137595035 16:49717799-49717821 TCTGTTCTGTGTGTTGCTGGAGG - Intronic
1151518005 17:74609153-74609175 TTGGTTCTGTATTTTGACGGGGG + Intergenic
1155203972 18:23541459-23541481 TCACTTCTGTTTACAGCCGGGGG + Intronic
932303303 2:70683742-70683764 TCGGCTCTGTCCAGTGCCGGGGG - Exonic
936262209 2:110970765-110970787 GAGGTTCAGTTTATTGCCTGTGG - Intronic
937042410 2:118832870-118832892 TCTGTTGTGTTTCCTGCCGGAGG + Intergenic
943729719 2:191289117-191289139 TCTGTTTTGTTTATTCCTGGCGG + Intronic
948727257 2:239942495-239942517 TCGGTTCTGTTTGCTTCCTGAGG + Intronic
1168903366 20:1384967-1384989 TGTGTTCTTTTTATTGCCGTTGG - Intronic
1175225065 20:57439820-57439842 TCGGTTCTGTCTGGTGCTGGAGG - Intergenic
1176282039 20:64318811-64318833 TCGGTTCTGTTTATTGCCGGGGG + Intergenic
1177241923 21:18469361-18469383 GAGGTTCTGTTTATTGCCCTTGG + Intronic
953836725 3:46352592-46352614 TCTGTTCTGTTTGTTACCTGTGG + Intergenic
955030148 3:55208755-55208777 TTGTTTCTGTTTTTTGCCTGTGG + Intergenic
955536843 3:59932683-59932705 TTTGTTCTGTTTATTGCAGTAGG - Intronic
960141017 3:114151944-114151966 TCGATTCTGTTAATTGCCTGGGG + Intronic
962195077 3:133354684-133354706 TGGGTTCTGTTTAATGGGGGAGG - Intronic
984698727 4:182804767-182804789 TCTGTTTTGTTTAGTGTCGGCGG - Intergenic
995458239 5:112374742-112374764 TCGGTTTTGATTTTTGCCTGGGG + Intronic
999340357 5:150764886-150764908 TGGGTGCTGTTTATGGCCTGAGG + Intergenic
1005163163 6:22888813-22888835 TTTGTTCTGTTTATTTGCGGTGG + Intergenic
1010054246 6:71546007-71546029 TCAGTTCTGTTTCTTACCAGTGG - Intergenic
1014882390 6:126739414-126739436 CTAGTTCTGTTTATTGCCTGGGG - Intergenic
1028391556 7:90322234-90322256 TCAGTTCTGTTTTGTGCAGGAGG - Intergenic
1030856205 7:114560620-114560642 TCAGTTCTTTTTTTTGGCGGAGG - Intronic
1048209653 8:132444109-132444131 TCCTTTCTGTGTATTGCCAGAGG - Intronic
1052006152 9:23351291-23351313 TCGTTCCTCTTTATTGCCAGGGG - Intergenic
1052598210 9:30589772-30589794 TCTGTTATGTTTATTGGAGGAGG - Intergenic
1189197302 X:39162919-39162941 TAGGTTCTCTTTATTGCGGCAGG + Intergenic