ID: 1091383652

View in Genome Browser
Species Human (GRCh38)
Location 12:78316-78338
Sequence CGCCCCTCCTCGGCCTCCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 456
Summary {0: 1, 1: 1, 2: 5, 3: 25, 4: 424}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091383638_1091383652 30 Left 1091383638 12:78263-78285 CCGGGGAGCATCGGGGCCGCGGC 0: 1
1: 0
2: 2
3: 8
4: 149
Right 1091383652 12:78316-78338 CGCCCCTCCTCGGCCTCCACGGG 0: 1
1: 1
2: 5
3: 25
4: 424
1091383649_1091383652 0 Left 1091383649 12:78293-78315 CCGGGTGCTGGGTGCTGGGTGCG 0: 1
1: 3
2: 6
3: 56
4: 400
Right 1091383652 12:78316-78338 CGCCCCTCCTCGGCCTCCACGGG 0: 1
1: 1
2: 5
3: 25
4: 424
1091383643_1091383652 14 Left 1091383643 12:78279-78301 CCGCGGCCTTCGGGCCGGGTGCT 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1091383652 12:78316-78338 CGCCCCTCCTCGGCCTCCACGGG 0: 1
1: 1
2: 5
3: 25
4: 424
1091383646_1091383652 8 Left 1091383646 12:78285-78307 CCTTCGGGCCGGGTGCTGGGTGC 0: 2
1: 0
2: 0
3: 11
4: 152
Right 1091383652 12:78316-78338 CGCCCCTCCTCGGCCTCCACGGG 0: 1
1: 1
2: 5
3: 25
4: 424

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091383652 Original CRISPR CGCCCCTCCTCGGCCTCCAC GGG Intronic
900393817 1:2444961-2444983 TGCCCCTCCCCGGCCTCCCATGG - Intronic
900422931 1:2563402-2563424 GGCCCCACCTCTCCCTCCACTGG - Exonic
900589937 1:3454969-3454991 CGACCCTCCTGGGGCTCCGCCGG + Intronic
900601362 1:3504107-3504129 GCCCCCTCCTCTGCCTCCCCTGG - Intronic
900601375 1:3504135-3504157 GCCCCCTCCTCTGCCTCCCCTGG - Intronic
901056057 1:6449067-6449089 CGCCGCTCCTCCTCGTCCACCGG + Exonic
901796372 1:11681639-11681661 CGCCCCTGCTCCGCCCCCACCGG + Intronic
903511839 1:23881643-23881665 CCGCCCGCCTCGGCCTCCAAAGG - Intronic
904004467 1:27356638-27356660 GGGCCCTGCTCGGGCTCCACCGG + Exonic
904162306 1:28530798-28530820 CGCCCCTCCTGCCTCTCCACTGG + Intronic
904574416 1:31494409-31494431 CTGCCCTCCTCGGCCTCCCAAGG + Intergenic
905916646 1:41689279-41689301 TGGCCTCCCTCGGCCTCCACAGG + Intronic
906288336 1:44602975-44602997 CACCCCTCCTCCTCCTCCTCGGG + Intronic
906520915 1:46466510-46466532 CGCCCCGCCCCGCCCTCCTCGGG + Intergenic
907080949 1:51621256-51621278 CTCCCCGCCTCGGCCTCCCAAGG - Intronic
908380992 1:63596498-63596520 CCACCCTCCTCGGCCTCCCAAGG + Intronic
912140559 1:106720518-106720540 CTGCCCTCCTCGGCCTCCCAAGG + Intergenic
914886413 1:151588160-151588182 CCACCCTCCTCGGCCTCCCAGGG - Intergenic
915126608 1:153670170-153670192 CCCTCCTCCTGGGCCTCCTCTGG + Exonic
917359370 1:174159528-174159550 CCGCCCTCCTCGGGCTCCAGCGG + Exonic
917984360 1:180299772-180299794 TTCCCCTCCTCTTCCTCCACTGG - Intronic
919463242 1:197902937-197902959 CGCCCCGCCGCGGCCGCCCCGGG + Intronic
920495872 1:206454557-206454579 CGCCCCAGCACGGCCTCCCCAGG + Intronic
921163338 1:212488176-212488198 CCCCCGTCCTGGCCCTCCACAGG + Intergenic
921257803 1:213357857-213357879 CCCTCCTCCTGGGCTTCCACAGG + Intergenic
921865767 1:220086515-220086537 CCACCCTCCTCGGCCTCCCAAGG + Intronic
922505154 1:226121926-226121948 CGCCCCTCCGCGGGCTCCCCAGG - Intergenic
922526673 1:226309344-226309366 CGCCCCTCCGCCGCCGCCTCCGG + Exonic
922635241 1:227162585-227162607 CCTCCCTCCTCGGCCTCCTTTGG - Intronic
923003035 1:230023250-230023272 AGCCCCTCCCCTTCCTCCACCGG - Intergenic
923631587 1:235652102-235652124 CTGCCCTCCTCGGCCTCCCAAGG + Intergenic
924126207 1:240854804-240854826 ATCCCCTCCCCGGCCTACACGGG + Intronic
1062844076 10:690839-690861 CTCGCCTCCCCGTCCTCCACGGG + Intergenic
1063079276 10:2749893-2749915 CAGCCCTCCTCGGCCTCCCAAGG - Intergenic
1064045274 10:12008385-12008407 CTGCCCACCTCGGCCTCCCCAGG - Intronic
1064418067 10:15168147-15168169 CGCCTCTCCTCGGCGCCCACCGG + Intronic
1064736349 10:18385366-18385388 CCCCCCCCCTCGCCCCCCACAGG + Intronic
1064752398 10:18544390-18544412 CCCCCCGCCCCGCCCTCCACAGG - Intergenic
1064999089 10:21320890-21320912 CGGCCCTCCTCGGCCTCCCAGGG - Intergenic
1065099515 10:22320602-22320624 CGCCCCGCCTCGGCCGCCCGCGG + Intronic
1065595794 10:27309786-27309808 CGACCCCCCTCGGCCTCCTGAGG - Intergenic
1066563380 10:36693481-36693503 CTGCCCGCCTCGGCCTCCAAAGG - Intergenic
1067015140 10:42752965-42752987 CCTCCCTCCTCGGCCTCGCCAGG + Intergenic
1068938381 10:62657718-62657740 CCCCCTACCTCGGCCTCCTCCGG + Intronic
1069387006 10:67892843-67892865 CCACCCTCCTCGGCCTCCCAAGG + Intronic
1069547485 10:69339050-69339072 AGCCCCTCCTGGCACTCCACTGG - Intronic
1070308031 10:75251398-75251420 CACCCCTCCTTGGCCTCCCAAGG - Intergenic
1071774310 10:88768065-88768087 GTCCCTTCCTGGGCCTCCACTGG - Intronic
1072656110 10:97331628-97331650 CTGCCCTCCTCGGCCTCCCAAGG - Intergenic
1073450011 10:103603605-103603627 GGGCCCTCCTCGGCCTCCTTGGG + Exonic
1074097320 10:110325534-110325556 CCTCCCACCTTGGCCTCCACTGG - Intergenic
1074882240 10:117668079-117668101 GGCCACTTCTCTGCCTCCACGGG - Intergenic
1074913330 10:117932120-117932142 CGGCCCACCTCGGCCTCCCAAGG - Intergenic
1076096359 10:127737298-127737320 GGCCCCTCCTCGGCCCCGCCCGG + Exonic
1076383484 10:130040585-130040607 CCACCCACCTCGGCCTCCCCAGG - Intergenic
1076688301 10:132208062-132208084 CGTTCCGCCTCGTCCTCCACAGG + Exonic
1077183726 11:1227460-1227482 CGCCCCCTCCCGGCCTCCCCGGG - Intronic
1077214131 11:1388352-1388374 CCCCCCTCCCCTGCCCCCACTGG + Intergenic
1077364184 11:2154893-2154915 CACCCCAGCCCGGCCTCCACAGG - Intronic
1077396817 11:2328210-2328232 CTGCCCTCCTCGGCCTGCACTGG + Intergenic
1077457100 11:2687804-2687826 CCCCCCTCCTCTGCCCCAACTGG + Intronic
1079296069 11:19235403-19235425 CCGCCCTCCTCGGCCTCCCAAGG - Intronic
1081424052 11:42905402-42905424 CCACCCTCCTCGGCCTCCCAAGG - Intergenic
1081492528 11:43579406-43579428 GGCCCCTCCCCGCCCCCCACGGG - Intronic
1081981773 11:47270883-47270905 CTCCCCTCCTCTACCTCCCCAGG - Intronic
1082959517 11:58905580-58905602 AACCCCTCCTTGGCTTCCACTGG + Intronic
1083482709 11:62959918-62959940 CCCCTCTCCTCCTCCTCCACTGG - Intronic
1083623404 11:64059878-64059900 CTCGCCTCCTCGGCCTTCAAGGG - Intronic
1083901498 11:65645655-65645677 CCCTCCTCCTCTCCCTCCACAGG - Intronic
1083933374 11:65857914-65857936 CGGCCCTCCCCGGCGCCCACGGG + Intronic
1083962564 11:66022513-66022535 CGCCCCTCCAGGGCCTTCTCGGG + Intronic
1084165470 11:67373108-67373130 CGCCCGGCCTCGGGCTCCCCCGG + Intronic
1084302182 11:68258975-68258997 CCACCCTCCTCGGCCTCCACTGG - Intergenic
1085423155 11:76380899-76380921 CTCCCCTCCCCGGCCCCGACGGG - Exonic
1085446154 11:76602579-76602601 CTCCCCTCCTGGGCCTCCTGGGG + Intergenic
1086306287 11:85484242-85484264 CGCCCCTCCTCCTCCTCCCTAGG + Intronic
1086728777 11:90222751-90222773 TGCCCCTCCTGGGCCTCCCTTGG - Intronic
1087143175 11:94786480-94786502 CCCTCCTCCTCAGCCCCCACAGG - Intronic
1089173880 11:116534780-116534802 CTCACCTCCCCGGCCTCCGCCGG + Intergenic
1091383652 12:78316-78338 CGCCCCTCCTCGGCCTCCACGGG + Intronic
1092794101 12:12093387-12093409 CCTCCCACCTCGGCCTCCCCAGG - Intronic
1092988028 12:13865825-13865847 CCCCCATCCTGGGCATCCACGGG - Exonic
1095085389 12:38053903-38053925 CCCCCCTCCCCAACCTCCACCGG - Intergenic
1096792635 12:54054416-54054438 CCACCCTCCTCGGCCCCCTCTGG + Intronic
1098277413 12:68826931-68826953 CCTCCCTCCTCGGCCTCCCAAGG - Intronic
1099233009 12:80049568-80049590 CCACCCGCCTCGGCCTCCAAAGG - Intergenic
1100540521 12:95553023-95553045 CTGCCCGCCTCGGCCTCCCCAGG + Intergenic
1102394576 12:112575275-112575297 CGTCCCTCCGCCGCCTCCAGCGG - Intronic
1102673953 12:114643717-114643739 CCTCCCTCCTCGGCCTCCCAAGG - Intergenic
1102854130 12:116278036-116278058 CCCTCCTCCGCGGCCACCACGGG - Intergenic
1103104056 12:118207081-118207103 CCACCCTCCTCGGCCTCCCAAGG - Intronic
1103511097 12:121474841-121474863 CCTCCTTCCTCGGCCTCCCCAGG - Intronic
1103578585 12:121897513-121897535 CCGCCCGCCTCGGCCTCGACAGG + Intronic
1103578608 12:121897641-121897663 CCGCCCGCCTCGGCCTCGACAGG + Intronic
1103957700 12:124587432-124587454 CCTCCCTCCTCAGCCTCCCCAGG + Intergenic
1104383035 12:128324614-128324636 CGTCCCGCCTCGGCCTCCCAAGG - Intronic
1104758987 12:131285879-131285901 AGCCCCTCCCCTGCCTCCCCTGG - Intergenic
1104821623 12:131680617-131680639 AGCCCCTCCCCTGCCTCCCCTGG + Intergenic
1105013498 12:132771846-132771868 CTCTCCTCCTCCTCCTCCACCGG + Exonic
1105416871 13:20220922-20220944 CCGCCCTCCTCGGCCTCCCAAGG - Intergenic
1106546967 13:30739085-30739107 CCCCCCTCCACCGCCTCCACCGG + Intronic
1106592038 13:31106110-31106132 CTCCCCTACTGGGGCTCCACGGG - Intergenic
1107099718 13:36576814-36576836 CCACCCTCCTTGGCCTCCTCTGG + Intergenic
1107212063 13:37869803-37869825 CGCCCCTCCCCCGCCTCCCATGG - Exonic
1107655651 13:42590007-42590029 TGCCCCTCCTGGGCCCACACGGG + Intronic
1107728858 13:43328085-43328107 CTTCCCTCCTCGACCTCAACTGG + Intronic
1110457501 13:75706217-75706239 TGCCCCTACTTGGCCTCAACAGG + Intronic
1112051129 13:95644474-95644496 TGCTGCTCCTCGGCCTCCGCGGG - Intronic
1113311690 13:109139477-109139499 CGCACCTCCGCAGCCTCCATGGG + Intronic
1113539195 13:111093409-111093431 CTCCCCTCCTCTCCCTCCATGGG - Intergenic
1113576141 13:111396507-111396529 CACCCCGCCTCCGCCCCCACAGG - Intergenic
1113636345 13:111921475-111921497 CGCCCCACCTGGCTCTCCACTGG - Intergenic
1113826033 13:113254353-113254375 CCACCCACCTCGGCCTCCCCAGG - Intronic
1113923590 13:113928349-113928371 TGCCCGGCCACGGCCTCCACAGG - Intergenic
1114070280 14:19099765-19099787 CCTCCCTCCTCGGCCTCGCCAGG - Intergenic
1114091981 14:19300237-19300259 CCTCCCTCCTCGGCCTCGCCAGG + Intergenic
1114178459 14:20344567-20344589 CTGCCCTCCTCGGCCTCCCAAGG - Intronic
1115329937 14:32186248-32186270 CCCACCTCCTTGGCCTCCTCAGG + Intergenic
1115361153 14:32504521-32504543 CTCCCCACCTCGGCCTCCCAGGG + Intronic
1115851700 14:37594827-37594849 CACCGCTCCCCGGCCTCCCCCGG + Intronic
1116460681 14:45169642-45169664 CCTCCCTCCTCGGCCTCCCAAGG + Intronic
1119677358 14:76565882-76565904 CCTCCCACCTCGGCCTCCAAAGG - Intergenic
1121199671 14:92106634-92106656 CGCCCCTCCCCGGCCCGCCCCGG + Intergenic
1122523474 14:102363178-102363200 AGCCCCTCCTCGGCCTCCCCCGG + Intronic
1122615113 14:103011870-103011892 CTCCCCGCCTCGGCCTCCCAAGG - Intronic
1123722014 15:23068417-23068439 CCGCCCTCCTCGGCCTCCGGGGG + Intergenic
1123834329 15:24172486-24172508 CCGCCCTCCTCGGCCTCCCATGG + Intergenic
1124564987 15:30804354-30804376 CTGCCCGCCTCGGCCTCCAGGGG - Intergenic
1124612175 15:31216100-31216122 CGCCCCACCTCAGCCTCCCGGGG + Intergenic
1124957194 15:34367211-34367233 CGCCCCTCGGCCGCCTGCACCGG - Exonic
1125720389 15:41842443-41842465 CGCCCCGCCACCGTCTCCACAGG - Intronic
1126032334 15:44511623-44511645 CTCCCCGCCTCGGCCTCCCAGGG - Intronic
1126849601 15:52789195-52789217 CGGCCATGCTCGGCCGCCACGGG - Exonic
1128075647 15:64823860-64823882 CGCCGCTCCTCGGGCTGCACAGG + Exonic
1128276563 15:66358658-66358680 CTCCCCTCCTCAGCCTCCCAAGG + Intronic
1128350229 15:66883568-66883590 CTTCCCTCCTCGCCCGCCACTGG + Intergenic
1128651184 15:69414694-69414716 CGCCCCGCCTGGGCCTCCAAGGG + Intronic
1129223864 15:74153992-74154014 CCGCCCTCCTCGGCCTCCCAAGG - Intergenic
1131074378 15:89486141-89486163 GCCCCCTCCTCAGCTTCCACGGG - Intronic
1131141792 15:89982429-89982451 CCACCCTCCTCGGCCTCCCAAGG + Intergenic
1132120060 15:99168764-99168786 CTCCTCTCCTCCTCCTCCACTGG + Intronic
1132178370 15:99733222-99733244 CGCCCCTCCCCGGGCTCCTAGGG - Intronic
1132610645 16:814261-814283 CAGCCCACCTCGGCCTCCCCAGG - Intergenic
1132618361 16:853122-853144 AGCCCCCCCTCGGCCTGCCCGGG - Intergenic
1132885615 16:2180831-2180853 GGCCCCACCTCGCCCTCCACGGG + Exonic
1132942157 16:2513768-2513790 CGCCCTGCCTCGGCCTCCGCGGG - Intronic
1133210472 16:4260762-4260784 CCTCCCACCTCGGCCTCCACTGG + Intronic
1137673920 16:50294499-50294521 CGTCCTTCCTCAGCCTCCATAGG - Intronic
1137926633 16:52547094-52547116 CGCTCCTCCTCCTCCTCCCCGGG + Intronic
1138316274 16:56072973-56072995 CACCCTTCCTGGGCCTCCTCAGG - Intergenic
1138678893 16:58671182-58671204 CGCCCCACGTCCTCCTCCACTGG + Exonic
1139113930 16:63926153-63926175 CCACCCTCCTCGGCCTCCCACGG + Intergenic
1140878235 16:79173219-79173241 CTCCCCTCCTGGGCCTCCTGAGG + Intronic
1141215386 16:82018997-82019019 CTGCCCTCCTTGGCCTCCCCAGG + Intergenic
1141620754 16:85235597-85235619 CGCCCCTCCTCTGCCACCACGGG + Intergenic
1141957881 16:87384386-87384408 CGCCCCTCCAAGCCCTCCCCGGG - Intronic
1142076326 16:88120185-88120207 CTCTCCTCCTCGGCAACCACGGG - Intergenic
1142429781 16:90019649-90019671 CGCCCCGCCGCGGACACCACCGG + Intronic
1142550102 17:732913-732935 AGCCCCTCCGCGTCCTCCCCTGG + Intronic
1142711697 17:1727090-1727112 CTCCCCTCCTCACCCTCCCCAGG - Exonic
1143036063 17:3999409-3999431 CCCCCCGCCTCGGCCTCCCAAGG - Intergenic
1143140523 17:4739661-4739683 CGCCCCTCCTCGCCCGCCGCCGG - Exonic
1143164488 17:4891095-4891117 GGTCCCTCCTGGGGCTCCACCGG - Exonic
1143480780 17:7226313-7226335 TGCCCCTCCCCTCCCTCCACAGG - Exonic
1143482588 17:7236209-7236231 CCCACCTCCTGGGCCTCCCCAGG - Exonic
1143494882 17:7307131-7307153 CGCCCCACCTCGGCTTTAACTGG - Intronic
1143861052 17:9890875-9890897 GGGCCCTCCTCAGCCTCCATGGG - Exonic
1144598434 17:16591206-16591228 CCACCCTCCTCGGCCTCCCAAGG + Intergenic
1145946013 17:28775224-28775246 CTCCCCACCTCGGCCTCCCAAGG + Intronic
1146315619 17:31804775-31804797 CGCCCAACCTCGGCCTCCCAAGG - Intergenic
1149812700 17:59692879-59692901 CCACCCTCCTCGGCCTCCCACGG + Intronic
1149965826 17:61163179-61163201 CTGCCCACCTCGGCCTCCCCAGG - Intronic
1150861248 17:68802981-68803003 CCACCCTCCTCGGCCTCCCAAGG + Intergenic
1151300273 17:73219404-73219426 CCACCCACCTCGGCCTCCAGAGG - Intronic
1151629928 17:75303577-75303599 CTCCCCGCCTCGGCCTCCCACGG + Intergenic
1151680186 17:75619037-75619059 CGCCCTCCATCGGCCTCCTCAGG + Intergenic
1152095766 17:78270686-78270708 CGGCCCTCCTCAGCCTCACCAGG - Intergenic
1152256440 17:79242753-79242775 CCCCCTTACTGGGCCTCCACAGG + Intronic
1152477853 17:80529808-80529830 CGTCCCTCCTCTGCCTCCCACGG - Intergenic
1152769515 17:82158442-82158464 CCACCCTCCTCGGCCTCCCAAGG - Intronic
1154327714 18:13404001-13404023 GGCCCCGCCTCAGCCTCCCCCGG - Intronic
1155401715 18:25446799-25446821 CTGCCCTCCTCGGCCTCCCAAGG + Intergenic
1155928702 18:31684720-31684742 CGCTCCTCCTCGCCCTTCCCCGG - Exonic
1155959501 18:31982234-31982256 CTGCCCTCCTCGGCCTCCCAAGG + Intergenic
1160036167 18:75303694-75303716 CCACCCACCTCGGCCTCCTCTGG + Intergenic
1160215898 18:76930672-76930694 CTCCCCTCCCTGCCCTCCACTGG - Intronic
1161051067 19:2164301-2164323 CTCCCCTCCTCCGCCGCCCCTGG + Intronic
1161133669 19:2606975-2606997 CCCCCCGCCTCGGCCTCCTGAGG - Intronic
1161288459 19:3480393-3480415 CTACCCTGCTGGGCCTCCACCGG + Exonic
1161315275 19:3614685-3614707 CTCCCCTCCTCTTCCCCCACAGG + Intronic
1161316345 19:3619323-3619345 GGCCCCTCCTCGGCTCCCACTGG - Intronic
1161346522 19:3771160-3771182 CTCCCCTCCTTGGCCTCCCTTGG + Intronic
1162581867 19:11536218-11536240 CGCCCCTCCCGGGCCGCCAGGGG + Intergenic
1163114065 19:15178783-15178805 CGCCCCTACTCCTCCTCCAAAGG + Intronic
1163427074 19:17245678-17245700 CGCCCCTCCCCCCCCGCCACGGG - Exonic
1163610929 19:18301203-18301225 CACCCCTGCCCCGCCTCCACTGG - Intergenic
1163815462 19:19462297-19462319 GGCCAATCCTCGGCCACCACAGG - Intronic
1164079395 19:21849564-21849586 CCACCCACCTCGGCCTCCCCAGG - Intronic
1164619972 19:29689585-29689607 CCCCTCTCCACAGCCTCCACAGG - Intergenic
1165036630 19:33038340-33038362 CCTCCCGCCTCAGCCTCCACAGG - Intronic
1165243270 19:34483265-34483287 CCGCCCTCCTCGGCCTCCCAAGG + Intronic
1165524142 19:36338440-36338462 CCTCCCTCCTTGGCCTCCAAAGG - Exonic
1165721517 19:38082517-38082539 CGGCCCTCGTCGGCCTCCCCCGG - Exonic
1166109719 19:40614504-40614526 CGCCCCTCCTCAGTCCCCAAGGG - Intronic
1166438038 19:42786182-42786204 CTCCCCTCCTGGGCCTACCCAGG + Intronic
1166734312 19:45075526-45075548 CCCCCCTCCACCGCCACCACTGG + Intronic
1167263086 19:48469824-48469846 CGCCCCTCCCCGGCCCCGGCAGG - Intronic
1167649053 19:50719649-50719671 CGCCCCTCCTCGCCCGCCCCCGG + Intergenic
1167694557 19:51007091-51007113 CGCCCCACCCCTGCCCCCACAGG + Intronic
1167792679 19:51691078-51691100 CGCCTCTCCTCCCCCTCCTCAGG + Intergenic
1168216242 19:54927982-54928004 CTACCCTCCTCGGCCTCCCAAGG - Intronic
1168385940 19:55963255-55963277 CTGCCCTCCTCGGCCTCCCAAGG + Intronic
925884273 2:8381035-8381057 AGCCTCTGGTCGGCCTCCACTGG + Intergenic
926679730 2:15654211-15654233 CCTCCCTCCTCGGCTTTCACAGG - Intergenic
927594162 2:24382343-24382365 CTGCCCTCCTCGGCCTCCCAAGG + Intergenic
928381715 2:30823837-30823859 AGCCCCTCCTCCACCACCACAGG - Intergenic
929468729 2:42169775-42169797 CGCCCCTCCGCGGACTCCGGTGG + Intronic
930177570 2:48315431-48315453 CGCCCCTCCACCGCCTCGAGGGG + Intronic
931045183 2:58343261-58343283 CCACCCTCCTCGGCCTCCCAAGG - Intergenic
932619585 2:73257843-73257865 CCCCCTTCCTTGGTCTCCACGGG - Exonic
932780218 2:74554647-74554669 CGCCCCTCCCCGGCCCCCGCCGG - Exonic
933809748 2:86025929-86025951 TGCACCTCCTAGGCCTACACTGG - Exonic
934069807 2:88373599-88373621 CCACCCGCCTCGGCCTCCAAAGG - Intergenic
934680383 2:96279482-96279504 CGCCCCTCATCGTCCTGCAAAGG + Exonic
934765973 2:96880253-96880275 CAGCCCTCCTCTGCCTGCACAGG - Intronic
935627288 2:105181561-105181583 CACCCCTCCTCTTCCTCCCCTGG - Intergenic
936038177 2:109129116-109129138 CGCCGCGCCCCGGCCTCCCCGGG + Intergenic
937252425 2:120533370-120533392 GGCCCCTCCCCAGCCCCCACAGG - Intergenic
937573027 2:123386924-123386946 CCACCCACCTCGGCCTCCAAAGG - Intergenic
937620960 2:123984540-123984562 CCGCCCTCCTCGGCCTCCCAAGG + Intergenic
937932613 2:127218830-127218852 CGCCCATCGTCCGCCTCCCCGGG - Intronic
938319793 2:130355527-130355549 TGCCCCTCCCCGGCCTCCCTTGG + Intergenic
938342510 2:130544853-130544875 CTGCCCTCCTCGGCCTCCAAGGG - Intronic
938347322 2:130575856-130575878 CTGCCCTCCTCGGCCTCCAAGGG + Intronic
938961429 2:136345053-136345075 CCCCCCACCTCGGCCTCCCAAGG - Intergenic
938968366 2:136408204-136408226 CGCCCTCCCTGGGCCTCTACTGG + Intergenic
939958675 2:148547421-148547443 CGCCCCACCTCCGCCTCCCAAGG - Intergenic
942169571 2:173276671-173276693 CCCCCCTCCTCAGCCTCCTGTGG + Intergenic
944766691 2:202871622-202871644 CGCCGCTCTTCCGCCTCCTCGGG + Intronic
947653635 2:231808171-231808193 CGTCCCTCCACGGCCTGAACTGG - Exonic
947990311 2:234482267-234482289 CTGCCCTCCTCGGCCTCCCAAGG - Intergenic
948654534 2:239468636-239468658 GGCCCCTCTGCAGCCTCCACTGG - Intergenic
949047230 2:241877683-241877705 CCCCCCTCCCCGACCTCCCCAGG + Intergenic
1169065513 20:2692700-2692722 CGCCCCGCCCCCGCCTCCCCCGG + Intergenic
1169264630 20:4160386-4160408 CCCCCCTACTCAGCCTCCCCAGG - Intronic
1171196138 20:23201054-23201076 CGCCACTCCTCAGCCTCCCTGGG - Intergenic
1172151564 20:32794233-32794255 CCTCCCACCTCAGCCTCCACAGG - Intronic
1173792044 20:45834124-45834146 CGCCCCTCCTCCTCCTGCGCCGG + Intronic
1174648267 20:52104233-52104255 CCCCCATCCCCCGCCTCCACTGG - Intronic
1174870187 20:54174284-54174306 CGCGCCTCCCCGCCCTCCCCCGG + Intergenic
1175813218 20:61869947-61869969 TCCCCCTCCTCCGCCTCCACAGG - Intronic
1176175184 20:63718697-63718719 CATCCCTCCTCGGCCTCCCAAGG + Intronic
1176177585 20:63735980-63736002 GGCCCCTCCTCGGGCAACACTGG - Exonic
1176281502 20:64316402-64316424 CGGCCCTCCTCGGCCTCCACGGG - Intergenic
1176309992 21:5144491-5144513 CGCACCTCCTCTGCCTCCCATGG - Intronic
1176380768 21:6111238-6111260 CGCCTCACCTCCGCCGCCACCGG - Exonic
1176597203 21:8758473-8758495 CCGCCCTCCTCGGCCTCCCAAGG - Intergenic
1176643020 21:9324414-9324436 CCGCCCTCCTCGGCCTCCCAAGG - Intergenic
1177152732 21:17470779-17470801 CCGCCCGCCTCGGCCTCCAAAGG - Intergenic
1177569141 21:22863675-22863697 CCACCCACCTCGGCCTCCGCTGG - Intergenic
1178191869 21:30292263-30292285 CGGCCCTCCTCAGCCTCCCAAGG - Intergenic
1178331382 21:31696576-31696598 TGCCTCTCCTCCTCCTCCACAGG - Exonic
1178461155 21:32803448-32803470 CACCCCTCCTTGACCTCAACGGG - Intronic
1178781165 21:35604450-35604472 CGCCCCACCACTGGCTCCACTGG + Intronic
1179124894 21:38581798-38581820 CCACCCTCCTCGGCCTCCCAAGG - Intronic
1179511241 21:41875203-41875225 CTCCCCTCCAGAGCCTCCACAGG + Intronic
1179742704 21:43427002-43427024 CGCCTCACCTCCGCCGCCACCGG + Exonic
1179847064 21:44117541-44117563 CGCACCTCCTCTGCCTCCCATGG + Intronic
1179889285 21:44327554-44327576 AGCCCCTCCTGGTCCTCCCCTGG + Intergenic
1179942682 21:44649976-44649998 CCTCCCTCCTCGGCCTCCCACGG - Intronic
1180054915 21:45352738-45352760 AGCCCCTCCTCGGCCTCCTCCGG + Intergenic
1180142040 21:45898709-45898731 CGGCCTCCCTCTGCCTCCACGGG + Intronic
1180142053 21:45898753-45898775 CGGCCTCCCTCTGCCTCCACGGG + Intronic
1180421244 22:12816362-12816384 CCGCCCTCCTCGGCCTCCCAAGG + Intergenic
1180488752 22:15822327-15822349 CCTCCCTCCTCGGCCTCGCCAGG - Intergenic
1180891278 22:19291230-19291252 CGCCCCTCCTTGGCGTCCTGCGG - Intronic
1182094002 22:27614225-27614247 CGCCCCCCCCCGGTCTCCAAGGG - Intergenic
1182445406 22:30386895-30386917 CGCCCCTCCCCAGGCTCCCCAGG - Intronic
1183061201 22:35337399-35337421 CGCCCCACCTCCCCCGCCACTGG + Intronic
1183484432 22:38081717-38081739 AGCCCCTCCCTGGCCCCCACAGG + Intronic
1184060170 22:42076832-42076854 TGACCCTCCTGGGCCTCTACTGG - Intronic
1184496757 22:44846607-44846629 TGCCCCTCCTTGCCCTCTACCGG + Intronic
1184782454 22:46656049-46656071 CCCCCCACCCCAGCCTCCACGGG + Intronic
1184946398 22:47807333-47807355 CACCCCTCCTAGGCATCCCCAGG + Intergenic
1184987498 22:48145671-48145693 TGCCCCTCCTCTGCCACCCCAGG + Intergenic
1185245028 22:49768992-49769014 CCCCACTCCCCGGCATCCACAGG + Intergenic
949274110 3:2257818-2257840 CGGCCCACCTCGGCCTCCCAAGG - Intronic
950456309 3:13094805-13094827 TGACCCTTCTGGGCCTCCACTGG + Intergenic
952241380 3:31533495-31533517 CGCCCCGCCTCAGGCTGCACGGG - Intronic
954144142 3:48626000-48626022 CTCCCCTCCTCTGCCTGCTCAGG - Exonic
954352948 3:50060502-50060524 CTGCCCGCCTCGGCCTCCCCAGG - Intronic
955561394 3:60194920-60194942 CCACCCTCCTCGGCCTCCTAAGG - Intronic
956417854 3:69052087-69052109 CGCCCCTCCTCAGCCGGCAGTGG + Exonic
958949541 3:100401348-100401370 CGCCCCTCCTCGGCTTCAGTAGG - Exonic
961211409 3:125128826-125128848 CCCCCCTCCTAGGCGTCCCCTGG - Intronic
961222590 3:125212381-125212403 CGCCGCCCCGCGGCCTCCGCAGG + Intronic
961252419 3:125518757-125518779 CCACCCTCCTCGGCCTCCCAAGG - Intronic
961360632 3:126365063-126365085 CGCCCCACCTCTGCCTGCAGAGG + Intergenic
961633086 3:128315569-128315591 CCTCCCTCCTGGGCCTCCCCAGG - Intronic
962058140 3:131895968-131895990 CCGCCCACCTTGGCCTCCACTGG - Intronic
962352984 3:134669269-134669291 CTGCCCACCTCGGCCTCCAAAGG + Intronic
962527529 3:136250201-136250223 CGACCCTCCTCGGGCAGCACCGG + Intergenic
963225561 3:142858180-142858202 GGTGCCTCCTCGGCATCCACAGG + Intronic
965321843 3:167261221-167261243 CACCCCTCCGCCACCTCCACTGG - Intronic
966862063 3:184236130-184236152 CGCCCTCCCTGGCCCTCCACAGG + Exonic
966941445 3:184750466-184750488 AGCCCCTCCTCTGCATCCAGAGG - Intergenic
967963747 3:194944710-194944732 CCGCCCGCCTCGGCCTCCCCAGG + Intergenic
968070117 3:195779497-195779519 AGCCCTTCCTCAGCATCCACAGG - Exonic
968070209 3:195779977-195779999 AGCCCTTCCTCAGCATCCACAGG - Exonic
968070280 3:195780361-195780383 AGCCCTTCCTCAGCATCCACAGG - Exonic
968070464 3:195781321-195781343 AGCCCTTCCTCAGCATCCACAGG - Exonic
968070511 3:195781561-195781583 AGCCCTTCCTCAGCATCCACAGG - Exonic
968070556 3:195781849-195781871 AGCCCTTCCTCAGCATCCACCGG - Exonic
968070581 3:195781993-195782015 AGCCCTTCCTCAGCATCCACAGG - Exonic
968070626 3:195782233-195782255 AGCCCTTCCTCAGCATCCACAGG - Exonic
968070654 3:195782377-195782399 AGCCCTTCCTCAGCATCCACCGG - Exonic
968070673 3:195782473-195782495 AGCCCTTCCTCAGCATCCACCGG - Exonic
968070798 3:195783193-195783215 AGCCCTTCCTCAGCATCCACAGG - Exonic
968070855 3:195783529-195783551 AGCCCTTCCTCAGCATCCACCGG - Exonic
968070880 3:195783673-195783695 AGCCCTTCCTCAGCATCCACAGG - Exonic
968070923 3:195783913-195783935 AGCCCTTCCTCAGCATCCACAGG - Exonic
968071038 3:195784537-195784559 AGCCCTTCCTCAGCATCCACAGG - Exonic
968071064 3:195784681-195784703 AGCCCTTCCTCAGCATCCACAGG - Exonic
968071107 3:195784921-195784943 AGCCCTTCCTCAGCATCCACAGG - Exonic
968071317 3:195786121-195786143 AGCCCTTCCTCAGCATCCACAGG - Exonic
968071361 3:195786361-195786383 AGCCCTTCCTCAGCATCCACAGG - Exonic
968071409 3:195786601-195786623 AGCCCTTCCTCAGCATCCACAGG - Exonic
968071475 3:195786937-195786959 AGCCCTTCCTCAGCATCCACAGG - Exonic
968071493 3:195787033-195787055 AGCCCTTCCTCAGCATCCACAGG - Exonic
968071547 3:195787369-195787391 AGCCCTTCCTCAGCATCCACAGG - Exonic
968071582 3:195787561-195787583 AGCCCTTCCTCAGCATCCACAGG - Exonic
968071600 3:195787657-195787679 AGCCCTTCCTCAGCATCCACAGG - Exonic
968071654 3:195787993-195788015 AGCCCTTCCTCAGCATCCACAGG - Exonic
968330503 3:197865109-197865131 CCTCCCTCCTCAGCCTCTACAGG + Intronic
1202743865 3_GL000221v1_random:80600-80622 CCGCCCTCCTCGGCCTCCCAAGG + Intergenic
968634983 4:1673488-1673510 CTACCCTCCTCGGCCTCCCAAGG - Intronic
968637844 4:1691310-1691332 CTGCCCTCCTCGGCCTCCCAAGG - Intergenic
968681600 4:1924665-1924687 CTACCCTCCTCGGCCTCCCAAGG - Intronic
968762544 4:2450110-2450132 CGCCCCTCCCCGGCCCTCAGTGG - Intronic
968891973 4:3374296-3374318 CTCCTCTCCTCCGACTCCACTGG + Intronic
969344788 4:6563820-6563842 CGCTCCTCCTCCGCCTCCTCCGG + Intergenic
969362600 4:6674219-6674241 CGCGCCTCGTCCGCGTCCACGGG - Intergenic
971337729 4:25739461-25739483 CTACCCTCCTCGGCCTCCCAAGG - Intergenic
973360497 4:49160692-49160714 CCGCCCTCCTCGGCCTCCCAAGG - Intergenic
973399587 4:49627221-49627243 CCGCCCTCCTCGGCCTCCCAAGG + Intergenic
973982263 4:56316295-56316317 GGCCCACCCTGGGCCTCCACCGG + Exonic
979360538 4:119758944-119758966 CGGCCCACCTCGGCCTCCCAGGG - Intergenic
980947230 4:139333631-139333653 CCTCCCACCTCGGCCTCCCCAGG - Intronic
982711085 4:158759429-158759451 CTGCCCTCCTCGGCCTCCCGAGG + Intergenic
983741625 4:171141274-171141296 CTCCTGTACTCGGCCTCCACAGG - Intergenic
985677756 5:1241047-1241069 CGCCCCTCCTGAGCCTGCACGGG - Intronic
988496522 5:31750474-31750496 CTCCTCTCCTCTACCTCCACGGG - Intronic
988532446 5:32039348-32039370 CTGCCCGCCTCGGCCTCCCCAGG + Intronic
996316673 5:122168285-122168307 CCGCCCGCCTCGGCCTCCCCTGG + Intronic
997417852 5:133742718-133742740 CACACCTCCTCAGCCTCCAGAGG - Intergenic
999312373 5:150559747-150559769 AGCCCCTCCTCACCCCCCACGGG + Intergenic
1001406524 5:171480999-171481021 CGCCCCACCTGGGGCTCCACTGG + Intergenic
1002318304 5:178359903-178359925 CAGCCCTCCTCGTTCTCCACTGG - Intronic
1002397289 5:178967980-178968002 CCGCCCACCTCGGCCTCCCCAGG + Intergenic
1002489987 5:179568990-179569012 CTCCCCTCCTGTGTCTCCACTGG - Intronic
1002683259 5:180986285-180986307 CCGCCCTCCTCGGCCTCCCAAGG + Intergenic
1002810190 6:621018-621040 TGCCACTCCTCAGCCTCCAGTGG + Intronic
1002924707 6:1598676-1598698 CGGACCTCCTCGGCCTTCAATGG + Intergenic
1003212469 6:4079486-4079508 CGGCCTTCCTGGGCCTCCTCGGG + Exonic
1004383344 6:15151039-15151061 CTGCCCACCTCGGCCTCCAAAGG + Intergenic
1004694810 6:18023794-18023816 CCGCCCTCCTCGGCCTCCTAAGG + Intergenic
1005287372 6:24342487-24342509 CGCTCCTTCTGGGCTTCCACAGG + Intronic
1007629126 6:43263096-43263118 CGCCGCTCTTCGCCCTCCTCGGG - Exonic
1007648164 6:43398643-43398665 CCGCCCGCCTCGGCCTCCAAAGG + Intergenic
1007764709 6:44153793-44153815 CGCCCATCCTCTGCCTCTTCTGG + Exonic
1013372682 6:109483566-109483588 CGCCCCTCCCCGCCCTGCCCCGG - Intergenic
1015952283 6:138565348-138565370 CCTCCCACCTCGGCCTCCCCAGG + Intronic
1016807702 6:148228890-148228912 CTGCCCGCCTCGGCCTCCAAAGG - Intergenic
1016851723 6:148626334-148626356 CCTCCCACCTCAGCCTCCACAGG - Intergenic
1018092500 6:160357070-160357092 CTCCCCTCCTTGGACTCTACAGG - Intronic
1018171020 6:161143028-161143050 CTCCCGACCTTGGCCTCCACAGG + Intronic
1018812028 6:167305337-167305359 AGCCCCTCCTGCTCCTCCACTGG + Intronic
1019355960 7:579111-579133 CGCCCGTCCGGGGCCTCCATGGG - Intronic
1020192165 7:6008858-6008880 CGCCACTCCGGGGCCTCCAGGGG + Intronic
1020234223 7:6343131-6343153 CCACCCTCCTCGGCCTCCCAAGG - Intronic
1020268704 7:6578944-6578966 CCTCCCGCCTCAGCCTCCACAGG + Intronic
1022245495 7:28555015-28555037 CCCCTCTCCTCCGCCTTCACTGG + Intronic
1022293653 7:29028719-29028741 TGCCCCACCTTGGCCTCCCCAGG - Intronic
1023738806 7:43259141-43259163 CCCCCCTCCTCTGCCTCCCAAGG - Intronic
1023847319 7:44129751-44129773 AGCCCCTCCCTGACCTCCACGGG - Intergenic
1023911641 7:44560664-44560686 CCCTCATCCTCGTCCTCCACGGG - Intergenic
1023977810 7:45044377-45044399 CCTCCCGCCTCGGCCTCCAAAGG + Intronic
1025130029 7:56370309-56370331 CGCCCCACCACGGCCTCCCGCGG + Intergenic
1025130335 7:56371559-56371581 CGCCCCACCACGGCCTCCCGCGG + Intergenic
1025130655 7:56372857-56372879 CGCCCCACCACGGCCTCCCGCGG + Intergenic
1025130971 7:56374151-56374173 CGCCCCACCACGGCCTCCCGCGG + Intergenic
1025625776 7:63219911-63219933 CCACCCTCCTCGGCCTCCCAAGG - Intergenic
1025656343 7:63523263-63523285 CCACCCTCCTCGGCCTCCCAAGG + Intergenic
1026172607 7:67967511-67967533 CTGCCCTCCTCAGCCTCCAAAGG + Intergenic
1026923737 7:74174550-74174572 CGCCGCTCCTAGGCCTCCGCGGG - Intronic
1028796246 7:94907600-94907622 CGCCCTTCCTTGGCCGCCAGAGG + Intronic
1028871245 7:95773077-95773099 CGCCCCGCCTCGGTCTTCCCCGG + Intronic
1030560268 7:111076493-111076515 AGCCTCACCTCAGCCTCCACTGG + Intronic
1031289955 7:119921917-119921939 CTGCCCTCCTCGGCCTCCCAAGG - Intergenic
1033105935 7:138523510-138523532 CCGCCCGCCTCGGCCTCCCCAGG - Intronic
1033795588 7:144841360-144841382 CCGCCCTCCTCGGCCTCCCACGG - Intergenic
1034114483 7:148571628-148571650 CCACCCTCCTCGGCCTCCTAAGG - Intergenic
1035437160 7:158867735-158867757 GGCCTCTCCTGGGCCTCCCCGGG + Intronic
1036661979 8:10714752-10714774 CGCCCCTCCTGGGCCTGAACCGG + Intergenic
1037910775 8:22742409-22742431 CTCCCCTCCTCTGCCCCCATCGG + Intronic
1038287328 8:26217108-26217130 CGCCCCGCCCCCGCCTCCCCAGG - Intergenic
1039457106 8:37714821-37714843 TGCCTCTCCTCTCCCTCCACTGG + Intergenic
1040004156 8:42604379-42604401 CCTCCCTCCTCAGCCTCCAGAGG + Intergenic
1040531613 8:48270871-48270893 TGCCCAGCCTGGGCCTCCACTGG - Intergenic
1040802261 8:51356243-51356265 CTGCCCTCCTCGGCCTCCCAAGG - Intronic
1043303364 8:78762494-78762516 CTCCCCTCCCCGGCCCCGACGGG - Intronic
1045472656 8:102526170-102526192 CCCCCCCCCTTGGCCTCCCCAGG + Intergenic
1048794599 8:138138186-138138208 CCTCCCTCCTCCTCCTCCACAGG + Intronic
1048928915 8:139295387-139295409 CCACCCACCTCGGCCTCCAGTGG - Intergenic
1049265557 8:141666107-141666129 GGCTCCTGCTCGCCCTCCACAGG + Intergenic
1049421450 8:142518399-142518421 GGCCCCTCCGAGGCCTCCACAGG + Intronic
1049518511 8:143075458-143075480 CCACCCTCCTCGGCCTCCCAAGG - Intergenic
1049591936 8:143466628-143466650 TGCCCCTCATGGGCCACCACGGG + Intronic
1049710037 8:144059333-144059355 CACCCCTCCTCTGCCTGAACAGG + Intronic
1049723531 8:144133456-144133478 CCACCCTCCTCGGCCCCCCCGGG - Intergenic
1050116885 9:2272205-2272227 CCACCCGCCTCGGCCTCCCCAGG + Intergenic
1051105992 9:13580979-13581001 CCCTGCTCCTCGGCCTCCTCCGG - Intergenic
1051206369 9:14693299-14693321 CGCGCCACCTCCGCCTCCTCCGG + Exonic
1051414587 9:16825611-16825633 CTCCCCTCCTCCTCCTCCCCAGG - Intronic
1053261430 9:36668754-36668776 CCGCCCTCCTCGGCCTCCCAAGG + Intronic
1053721349 9:40950215-40950237 CCACCCGCCTCGGCCTCCAAAGG + Intergenic
1054344649 9:63901953-63901975 CCACCCACCTCGGCCTCCAAAGG - Intergenic
1055150281 9:72989817-72989839 CTGCCCACCTCGGCCTCCAAAGG - Intronic
1056229498 9:84527979-84528001 CTCCCCACCTCGGCCTCCCGAGG - Intergenic
1056817438 9:89811848-89811870 CTCCCCACCTGGGACTCCACAGG - Intergenic
1058609216 9:106756835-106756857 CTGCCCTCCTCGGCCTCCCAAGG + Intergenic
1059146429 9:111903837-111903859 CTGCCTGCCTCGGCCTCCACAGG + Intronic
1059554988 9:115271644-115271666 CTGCCCTCCTCAGCCTCCCCAGG - Intronic
1060629605 9:125143582-125143604 CGCCTCTCCTCGGCTCCCATTGG + Intergenic
1060719922 9:125969931-125969953 CACCCCTCGTGGGACTCCACCGG - Intergenic
1061231762 9:129319674-129319696 CTCCCGGCCCCGGCCTCCACGGG - Intergenic
1061290885 9:129649720-129649742 GCGCCCTCCCCGGCCTCCACTGG - Intergenic
1061773264 9:132944280-132944302 CGCCCCTCCTTGGCCCCCGAGGG - Intronic
1061876529 9:133546865-133546887 TGCCCCTCCTCCGCATTCACTGG + Intronic
1062000531 9:134213682-134213704 GGCCCCTCCTGGACCTCCCCTGG - Intergenic
1062459919 9:136658763-136658785 CGCCCCTCCTCGGCCTTGCTGGG - Intergenic
1062514710 9:136926838-136926860 CTCCTCTCCTGGGCCTCCCCAGG + Intronic
1062621357 9:137423773-137423795 CGCCCCTCCCCGACCGTCACGGG + Intronic
1203489889 Un_GL000224v1:94867-94889 CCCCCCACCTCGGCCTCCCAAGG - Intergenic
1203502512 Un_KI270741v1:36753-36775 CCCCCCACCTCGGCCTCCCAAGG - Intergenic
1203712497 Un_KI270742v1:110565-110587 CCGCCCTCCTCGGCCTCCCAAGG + Intergenic
1203556097 Un_KI270743v1:208883-208905 CCGCCCTCCTCGGCCTCCCAAGG + Intergenic
1185459336 X:327695-327717 CCCCCCACCTCGGCCTCCGAAGG + Intergenic
1185750924 X:2609224-2609246 CGCCCCACCCCGGCCTCCACTGG - Intergenic
1185984097 X:4811285-4811307 CTCCCTTCCTCTGCCCCCACAGG + Intergenic
1186504903 X:10083391-10083413 GGCCACTCCTTGGCCTCCAGGGG - Intronic
1187380952 X:18801737-18801759 CGACCCACCTCGGCCTCCCAAGG - Intronic
1189882258 X:45504632-45504654 CTGCCCCCCTCGGCCTCCCCAGG - Intergenic
1192779380 X:74278592-74278614 CCACCCGCCTCGGCCTCCCCAGG + Intergenic
1195660348 X:107371850-107371872 TGCCTCTCCTCCACCTCCACAGG + Intergenic
1200634512 Y:5633969-5633991 CTGCCCTCCTCGGCCTCCCAAGG - Intronic