ID: 1091383664

View in Genome Browser
Species Human (GRCh38)
Location 12:78345-78367
Sequence TCGCACCATCACACTAGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 2, 1: 0, 2: 0, 3: 3, 4: 83}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091383664_1091383673 16 Left 1091383664 12:78345-78367 CCGGGGCTAGTGTGATGGTGCGA 0: 2
1: 0
2: 0
3: 3
4: 83
Right 1091383673 12:78384-78406 AAGAAGGGGACATTGAGGCGGGG 0: 2
1: 0
2: 3
3: 32
4: 342
1091383664_1091383676 25 Left 1091383664 12:78345-78367 CCGGGGCTAGTGTGATGGTGCGA 0: 2
1: 0
2: 0
3: 3
4: 83
Right 1091383676 12:78393-78415 ACATTGAGGCGGGGGCGGCTAGG 0: 2
1: 0
2: 1
3: 6
4: 89
1091383664_1091383679 30 Left 1091383664 12:78345-78367 CCGGGGCTAGTGTGATGGTGCGA 0: 2
1: 0
2: 0
3: 3
4: 83
Right 1091383679 12:78398-78420 GAGGCGGGGGCGGCTAGGAGGGG 0: 2
1: 0
2: 2
3: 48
4: 650
1091383664_1091383672 15 Left 1091383664 12:78345-78367 CCGGGGCTAGTGTGATGGTGCGA 0: 2
1: 0
2: 0
3: 3
4: 83
Right 1091383672 12:78383-78405 GAAGAAGGGGACATTGAGGCGGG 0: 2
1: 1
2: 6
3: 48
4: 587
1091383664_1091383678 29 Left 1091383664 12:78345-78367 CCGGGGCTAGTGTGATGGTGCGA 0: 2
1: 0
2: 0
3: 3
4: 83
Right 1091383678 12:78397-78419 TGAGGCGGGGGCGGCTAGGAGGG 0: 2
1: 0
2: 0
3: 18
4: 286
1091383664_1091383667 1 Left 1091383664 12:78345-78367 CCGGGGCTAGTGTGATGGTGCGA 0: 2
1: 0
2: 0
3: 3
4: 83
Right 1091383667 12:78369-78391 TAGATTGCCTTGGAGAAGAAGGG 0: 1
1: 1
2: 2
3: 23
4: 308
1091383664_1091383670 11 Left 1091383664 12:78345-78367 CCGGGGCTAGTGTGATGGTGCGA 0: 2
1: 0
2: 0
3: 3
4: 83
Right 1091383670 12:78379-78401 TGGAGAAGAAGGGGACATTGAGG 0: 2
1: 0
2: 3
3: 41
4: 489
1091383664_1091383675 20 Left 1091383664 12:78345-78367 CCGGGGCTAGTGTGATGGTGCGA 0: 2
1: 0
2: 0
3: 3
4: 83
Right 1091383675 12:78388-78410 AGGGGACATTGAGGCGGGGGCGG 0: 2
1: 0
2: 2
3: 42
4: 487
1091383664_1091383668 2 Left 1091383664 12:78345-78367 CCGGGGCTAGTGTGATGGTGCGA 0: 2
1: 0
2: 0
3: 3
4: 83
Right 1091383668 12:78370-78392 AGATTGCCTTGGAGAAGAAGGGG 0: 1
1: 1
2: 3
3: 24
4: 324
1091383664_1091383665 -9 Left 1091383664 12:78345-78367 CCGGGGCTAGTGTGATGGTGCGA 0: 2
1: 0
2: 0
3: 3
4: 83
Right 1091383665 12:78359-78381 ATGGTGCGAGTAGATTGCCTTGG 0: 1
1: 1
2: 0
3: 1
4: 47
1091383664_1091383671 14 Left 1091383664 12:78345-78367 CCGGGGCTAGTGTGATGGTGCGA 0: 2
1: 0
2: 0
3: 3
4: 83
Right 1091383671 12:78382-78404 AGAAGAAGGGGACATTGAGGCGG 0: 2
1: 0
2: 3
3: 46
4: 543
1091383664_1091383674 17 Left 1091383664 12:78345-78367 CCGGGGCTAGTGTGATGGTGCGA 0: 2
1: 0
2: 0
3: 3
4: 83
Right 1091383674 12:78385-78407 AGAAGGGGACATTGAGGCGGGGG 0: 2
1: 0
2: 2
3: 36
4: 422
1091383664_1091383677 28 Left 1091383664 12:78345-78367 CCGGGGCTAGTGTGATGGTGCGA 0: 2
1: 0
2: 0
3: 3
4: 83
Right 1091383677 12:78396-78418 TTGAGGCGGGGGCGGCTAGGAGG 0: 2
1: 0
2: 0
3: 11
4: 216
1091383664_1091383666 0 Left 1091383664 12:78345-78367 CCGGGGCTAGTGTGATGGTGCGA 0: 2
1: 0
2: 0
3: 3
4: 83
Right 1091383666 12:78368-78390 GTAGATTGCCTTGGAGAAGAAGG 0: 1
1: 1
2: 0
3: 55
4: 588

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091383664 Original CRISPR TCGCACCATCACACTAGCCC CGG (reversed) Intronic
901467717 1:9433319-9433341 TGTCACCATCACACTAGCTCTGG - Intergenic
904601854 1:31677442-31677464 TTGAACTATCACACTGGCCCTGG - Intronic
906123843 1:43414233-43414255 TCGCACCTGCACTCTAGCCTGGG + Intronic
917336635 1:173930234-173930256 TCGCACCACTACACCAGCCTGGG - Intergenic
919826538 1:201507216-201507238 TCGCGCCATGACATCAGCCCTGG - Exonic
921785022 1:219219746-219219768 TCACACAAACACACAAGCCCAGG + Intergenic
1064102881 10:12478344-12478366 TCACACCAACACTCTAGCCTGGG - Intronic
1065499226 10:26362722-26362744 TCACACCCACACTCTAGCCCTGG + Intergenic
1066749085 10:38634570-38634592 TCGCACCAGCACTCCAGCCTGGG - Intergenic
1066967577 10:42283221-42283243 TCGCACCAGCACTCCAGCCTGGG + Intergenic
1070648705 10:78219558-78219580 TCTCACCATCACACTGCCTCGGG - Intergenic
1071075282 10:81743264-81743286 TCGCACCATTACACTCAGCCTGG + Intergenic
1074686870 10:115969915-115969937 TCGCAGGATCACTCCAGCCCAGG - Intergenic
1078038120 11:7829552-7829574 TCACAGCATCACATTAGCTCAGG - Intergenic
1078936854 11:15959157-15959179 TTGGACAAGCACACTAGCCCTGG - Intergenic
1090112410 11:123927937-123927959 TAGAAGGATCACACTAGCCCAGG - Intergenic
1091383664 12:78345-78367 TCGCACCATCACACTAGCCCCGG - Intronic
1091771558 12:3155449-3155471 GCGCACCACCACACCAGGCCTGG - Intronic
1093754051 12:22832770-22832792 TCGCTTAATCACACTAGTCCTGG - Intergenic
1096067539 12:48753117-48753139 TCTCACCATAACACAAGTCCAGG + Intergenic
1104872431 12:132009531-132009553 TCTCACCCTCACACTGGCCTCGG - Intronic
1109454642 13:62568411-62568433 TCACATCATCGCACTAGCCTTGG - Intergenic
1112384077 13:98921810-98921832 CTGCACCTTCACACCAGCCCAGG + Intronic
1112504807 13:99969347-99969369 ACGCAGTATCACACTCGCCCTGG - Intronic
1114260687 14:21034123-21034145 TCAGACCATTACAATAGCCCCGG + Exonic
1119563798 14:75611691-75611713 TCGCACCACTGCACTAGCCTGGG + Intronic
1123461014 15:20471918-20471940 TTGCACCACCACTCTAGCCTGGG - Intergenic
1123999858 15:25747242-25747264 TCGCACCAACACTCCAGCCTGGG + Intronic
1124271659 15:28287766-28287788 TTGCACCACCACTCTAGCCTGGG - Intronic
1124310959 15:28623638-28623660 TTGCACCACCACTCTAGCCTGGG + Intergenic
1136733642 16:32442563-32442585 TCGCACCAGCACTCCAGCCTGGG + Intergenic
1140604446 16:76517826-76517848 TCGCTCCATCTCCCTAACCCTGG + Intronic
1203019441 16_KI270728v1_random:387039-387061 TCGCACCAGCACTCCAGCCTGGG - Intergenic
1203037776 16_KI270728v1_random:660197-660219 TCGCACCAGCACTCCAGCCTGGG - Intergenic
1145023274 17:19448590-19448612 GCGAACCATCACACTGGCCCAGG + Intergenic
1151934465 17:77253629-77253651 TCGCCCCAACACACTAGGCAAGG - Intergenic
1156526478 18:37772631-37772653 TAGAACCACCATACTAGCCCTGG - Intergenic
1158782026 18:60663286-60663308 TCACACCATCACCCTCGCCAGGG + Intergenic
1160475868 18:79187268-79187290 TTTCACCCTCACAGTAGCCCAGG + Intronic
1160910623 19:1472248-1472270 GCTCACCCTCACACTCGCCCCGG + Exonic
1162310316 19:9902748-9902770 TCGCACCAGCACTCCAGCCTAGG - Intronic
1165741096 19:38205772-38205794 TCCCACCTTCACACTACCCGAGG - Intronic
925317256 2:2935930-2935952 TCGCCTCCTCACGCTAGCCCAGG - Intergenic
927021607 2:19022770-19022792 TGGAGCCACCACACTAGCCCAGG - Intergenic
929938401 2:46311764-46311786 TCTCAACATCTCACTAGCCAAGG - Intronic
933591529 2:84238294-84238316 TCACAGCATCACACTAGCCTTGG + Intergenic
934312075 2:91876703-91876725 TCGCACCAGCACTCCAGCCTGGG - Intergenic
945238889 2:207658689-207658711 TCGCACCATTGCACCAGCCTGGG + Intergenic
1172188668 20:33048570-33048592 TCGCACCACCACTCCAGCCTGGG + Intergenic
1172834806 20:37866288-37866310 TACCACCACCACACTACCCCGGG - Intronic
1176281491 20:64316373-64316395 TCGCACCATCACACTAGCCCCGG + Intergenic
1177006559 21:15679735-15679757 TCACACCACCGCACTAGCCTGGG + Intergenic
1182429614 22:30292065-30292087 TCACACCAGCACCCTAACCCTGG + Exonic
950122773 3:10492791-10492813 CCTCACCATCACACTTGACCCGG - Intronic
953587444 3:44216593-44216615 TTGCAGCATCACAATAGCCAAGG + Intergenic
958142079 3:89573990-89574012 TCCCACCACCACACTCGGCCTGG + Intergenic
961156710 3:124685805-124685827 TCGCACCCTCACCCTAGACTGGG + Intronic
963481561 3:145880766-145880788 TCTCGCCATCACACTAGGGCAGG + Intergenic
964540791 3:157777423-157777445 CCAAACCATCACACTGGCCCTGG - Intergenic
968562947 4:1294653-1294675 TCTCCCCATCATGCTAGCCCAGG - Intronic
969481605 4:7449391-7449413 CAGCACCTTCACAATAGCCCAGG + Intronic
972576431 4:40356268-40356290 TTGCACCACTACACTAGCCTAGG + Intergenic
977772770 4:100879512-100879534 TTGCACCATTACAGTAGGCCAGG - Intronic
981012231 4:139937429-139937451 TTGCACCACCACACTATCCTGGG - Intronic
996579457 5:125015266-125015288 TGGCATCATCACAATAGCTCTGG - Intergenic
997597895 5:135119312-135119334 TCCCATCATCACTCTGGCCCTGG - Intronic
999255183 5:150206030-150206052 TCACACCATCATTCTATCCCGGG - Intronic
1004709479 6:18155792-18155814 ACGCCCCAACACCCTAGCCCGGG - Intronic
1006716090 6:36121487-36121509 TCACTCCCTCACACTTGCCCAGG - Intergenic
1010372183 6:75123333-75123355 TCCCACCATTCCACCAGCCCGGG - Exonic
1010800941 6:80175054-80175076 AGGAACTATCACACTAGCCCTGG - Intronic
1014607257 6:123492351-123492373 AAGCACAAGCACACTAGCCCTGG + Intronic
1023759897 7:43455693-43455715 TCACACCATCACACCATCACGGG + Intronic
1027260033 7:76458315-76458337 TTGCACCATTGCACTAGCCTGGG - Intergenic
1027282438 7:76618574-76618596 TTGCACCATTGCACTAGCCTGGG + Intronic
1027311408 7:76956419-76956441 TTGCACCATTGCACTAGCCTGGG - Intergenic
1030301166 7:107976359-107976381 TCCCACCACCACACCAGGCCAGG + Intronic
1033380732 7:140815476-140815498 TCGCACCATTGCACAAGCCTGGG - Intronic
1035609185 8:948869-948891 TCCCACCCTAACACCAGCCCTGG - Intergenic
1036490430 8:9220324-9220346 TCGCACCACTACACTCACCCTGG - Intergenic
1042684964 8:71427933-71427955 TGGCACCATTACACTAAGCCTGG + Intronic
1043877728 8:85505397-85505419 TCGCTCCATCACTCCAGCTCAGG - Intergenic
1046820809 8:118632413-118632435 TTTCACCTTCACAATAGCCCTGG + Intergenic
1056170484 9:83980277-83980299 TCGCACCATCGCTGAAGCCCTGG - Intronic
1056959106 9:91106080-91106102 CCGCACCTTCACACTGACCCAGG + Intergenic
1058543015 9:106031452-106031474 TTGCACCATTACAAGAGCCCTGG - Intergenic
1060330357 9:122662984-122663006 TCGCTTCATCATATTAGCCCAGG + Intergenic
1062268262 9:135697262-135697284 TCCCACCTCCACACCAGCCCAGG + Intronic