ID: 1091386418

View in Genome Browser
Species Human (GRCh38)
Location 12:98856-98878
Sequence GAGGGCGTGCAGAAGTAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 925
Summary {0: 1, 1: 0, 2: 8, 3: 118, 4: 798}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091386418 Original CRISPR GAGGGCGTGCAGAAGTAGGA AGG Intronic
901535162 1:9877960-9877982 GTGGCTGGGCAGAAGTAGGAAGG + Exonic
901631062 1:10648364-10648386 GAGGAAGGGCACAAGTAGGAAGG - Intronic
902098526 1:13966187-13966209 GAGGGAGGGAAGGAGTAGGAGGG - Intergenic
902397484 1:16140249-16140271 GAGGGTCTGCAGAAGCAGGATGG - Intronic
902768273 1:18631048-18631070 GAAGGCGTGGAGAAGAGGGAGGG + Exonic
903000814 1:20264323-20264345 GAGGTCATGCTGGAGTAGGATGG - Intergenic
904887420 1:33751328-33751350 GAGGGTTTCCAGAAGGAGGAAGG + Intronic
905040871 1:34957166-34957188 GAGGATGTGGAGAAATAGGAAGG + Intergenic
905237817 1:36562181-36562203 GAGGAAGAGCAGAAGGAGGAAGG - Intergenic
905448573 1:38043306-38043328 GAGAGCCTGCTGGAGTAGGATGG + Intergenic
905516936 1:38568943-38568965 GAGGGCTTCCAGAAGTAAGAGGG + Intergenic
905709153 1:40086209-40086231 CAGGGAGTGTAGAGGTAGGAGGG + Intronic
906579634 1:46925692-46925714 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
906604089 1:47153196-47153218 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
907049802 1:51322222-51322244 GAGGCCTTGGAGAAGGAGGAGGG - Intronic
908453448 1:64278935-64278957 GAGGATGTGGAGAAATAGGAAGG + Intergenic
908465507 1:64389615-64389637 GAGGATGTGGAGAAATAGGAAGG - Intergenic
908584706 1:65555007-65555029 GAGGGTGAGCTGAAGCAGGATGG - Intronic
908592788 1:65651826-65651848 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
908732353 1:67239022-67239044 GAGGGAGTGAGGAAGGAGGATGG + Intronic
908780748 1:67686850-67686872 GAGGCAGTGCAGATGTAGGTAGG - Intronic
908976323 1:69903322-69903344 GAGGGCGAGCGGAAGCAGGGTGG + Intronic
910330918 1:86071855-86071877 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
910606339 1:89088831-89088853 GAGGGCGAACAGAAGCAGGGTGG - Intergenic
910635784 1:89405728-89405750 GAGAGCGAGCAGAAGCAGGGTGG - Intergenic
910827916 1:91428731-91428753 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
911117497 1:94260990-94261012 ATGGGGGTGCAGAATTAGGAAGG - Intronic
911530626 1:99039398-99039420 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
911632570 1:100199742-100199764 GAGGGCCAGCAGAAGCAGGATGG + Intronic
912188155 1:107305365-107305387 GAGGATGTGGAGAAATAGGAAGG - Intronic
912235253 1:107844165-107844187 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
912675714 1:111679235-111679257 GAGGGCTAGCAGAAGCAGGGTGG + Intronic
912860416 1:113209208-113209230 GATGGCATGCAGAAGGAAGAGGG + Intergenic
912894948 1:113576453-113576475 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
913021535 1:114792626-114792648 GAGGGCGAGCAAAAGTAGGGTGG - Intergenic
913102815 1:115584819-115584841 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
913108742 1:115639768-115639790 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
914005384 1:143728535-143728557 GAGGGCCTGAAGAAAGAGGAAGG + Intergenic
914097864 1:144559794-144559816 GAGGGCCTGAAGAAAGAGGAAGG + Intergenic
914457972 1:147854715-147854737 GAGGGCAAGCAGAAGCAGGGAGG + Intergenic
914784742 1:150818056-150818078 GAGGGGGTGGAGAGGGAGGAAGG + Intronic
915061443 1:153188947-153188969 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
915100372 1:153495039-153495061 GAGGGCAGGCAGAGGAAGGAGGG - Intergenic
915288519 1:154867948-154867970 GAGGGAGTGGAGATGGAGGAAGG - Intronic
915876444 1:159616219-159616241 AAGAGCGAGCAGAAGTAGGGTGG + Intergenic
916140462 1:161693008-161693030 GAGAGCGAGCAGAAGCAAGATGG + Intergenic
916288423 1:163136259-163136281 GAGGTTGTGGAGAAATAGGAAGG - Intronic
916362788 1:163990127-163990149 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
916612881 1:166410202-166410224 GAGGGCGAGCAGAAGCAGAGTGG - Intergenic
916731678 1:167572196-167572218 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
916912788 1:169368556-169368578 GAGGGGGTGAAGAAGTAAGTAGG - Intronic
917019293 1:170569019-170569041 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
917023455 1:170614823-170614845 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
917257346 1:173129905-173129927 GAGGATGTGGAGAAATAGGAAGG - Intergenic
917764187 1:178199275-178199297 GAGGGCGAGCTGAAGGAGGGTGG - Intronic
918163278 1:181920580-181920602 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
918327717 1:183426346-183426368 GAGGGAGGGAATAAGTAGGAGGG - Intergenic
918632154 1:186730806-186730828 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
920588770 1:207196107-207196129 GAGGGCGAGCTGAAGCAGGATGG + Intergenic
920985508 1:210885255-210885277 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
920993192 1:210959879-210959901 GAGGGCGAGCTGAAGCAGGGCGG - Intronic
921461629 1:215433449-215433471 GAGGGCAAGCTGAAGCAGGATGG - Intergenic
921631261 1:217437077-217437099 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
921962153 1:221047279-221047301 GAGGGTGAACAGAAGTAGGGTGG + Intergenic
921976253 1:221206728-221206750 GAGGGCGAGCTGAAGCAGGGTGG + Intergenic
922066129 1:222145642-222145664 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
922154252 1:223029016-223029038 GATGGGGTGCAGAAATAGGTCGG + Intergenic
922396719 1:225209845-225209867 AAGGGCGAGCAGAAGCAGGGTGG + Intronic
922715928 1:227872034-227872056 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
923853345 1:237820368-237820390 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
924290345 1:242529818-242529840 GAGGGAGAGAAGAAGAAGGAAGG - Intergenic
924883390 1:248187685-248187707 GAGAGTGAGCAGAAGCAGGATGG + Intergenic
1062779639 10:190370-190392 GAGGGTGTGCAGAAGAGGCAGGG - Intronic
1066159578 10:32714246-32714268 GAGGGCGAGCAGAAGCAGGGTGG + Intronic
1066615468 10:37289057-37289079 CAGGGTGAGCAGAAGCAGGATGG - Intronic
1066985223 10:42459641-42459663 GAGGGAGTAAAGAAGAAGGAAGG + Intergenic
1066993574 10:42540000-42540022 GAGGGTGAGCCGAAGCAGGATGG - Intergenic
1067082542 10:43219673-43219695 GAGGGCCTCCAGAGGCAGGAAGG + Intronic
1067797244 10:49329526-49329548 GAGGGCGTGAGGAAGGAAGAAGG - Intergenic
1068350059 10:55831426-55831448 GAGGTCATGCAGAAGCAGGGTGG - Intergenic
1068357188 10:55923806-55923828 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1068495306 10:57778992-57779014 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1068646105 10:59470265-59470287 GAGGGCGAGCCGAAGCAGGGTGG + Intergenic
1068759324 10:60690255-60690277 GAGGGCGAGCTGAAGCAGGGCGG + Intronic
1069120899 10:64567792-64567814 GAGGGTGAGCAGAAGTAGGGAGG - Intergenic
1069348452 10:67497561-67497583 GAGGACGTGGAGAAATAGGAAGG - Intronic
1069821677 10:71232406-71232428 GAGGGAGTGCACAAGGAGGGAGG + Intronic
1070213086 10:74347277-74347299 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1070349175 10:75575716-75575738 GAGGGTGAGCCGAAGCAGGAGGG + Intronic
1070440048 10:76434362-76434384 GAGGGAGTGAAGAGATAGGAGGG - Intronic
1070871471 10:79757618-79757640 GAGGGCGTGAAGAGGAAAGAAGG + Intergenic
1070936720 10:80304200-80304222 GAGGGCGAGCCAAAGCAGGATGG + Intergenic
1070999653 10:80817722-80817744 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1071001527 10:80836408-80836430 GAGGATGTGAAGAAATAGGAAGG - Intergenic
1071638404 10:87279826-87279848 GAGGGCGTGAAGAGGAAAGAAGG + Intergenic
1071656838 10:87458126-87458148 GAGGGCGTGAAGAGGAAAGAAGG - Intergenic
1072044795 10:91643987-91644009 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1072404324 10:95136032-95136054 GAGGGAGAGCAGAAGCAGGGTGG + Intergenic
1072493788 10:95934683-95934705 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1072876093 10:99174959-99174981 GAAGGCGAGCAGAAGCAGGGTGG + Intronic
1073602671 10:104862012-104862034 GAGGGCATACTGCAGTAGGATGG - Intronic
1074015463 10:109529867-109529889 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1074532045 10:114304937-114304959 GAGGAAGTGCAGATGCAGGAGGG + Intronic
1074532131 10:114305213-114305235 GAGGGCATGCAGATAAAGGAGGG + Intronic
1074631503 10:115259588-115259610 GAGGGCGAGCCGAAGCAGGGTGG - Intronic
1075600190 10:123761910-123761932 GAGGACTTCCAGAAGGAGGAGGG - Exonic
1076676062 10:132148442-132148464 GAGGACGGGCAGATGGAGGACGG - Intronic
1076694803 10:132242310-132242332 GGGGGAGTGCAGCAGGAGGACGG + Intronic
1076706763 10:132306648-132306670 GATAGCGTGCAGAGGTATGATGG - Intronic
1077220259 11:1412625-1412647 GAGGGCGTCCAGTGGTGGGAGGG + Intronic
1077220667 11:1414239-1414261 GAGGCCGGGCAGGAGGAGGACGG + Intronic
1077325784 11:1963434-1963456 GAAGGAGTGGAGAAGCAGGAAGG - Intronic
1078072001 11:8120052-8120074 GAGGATGTGGAGAAATAGGAAGG + Intronic
1078523134 11:12079381-12079403 GAGGCTGTGGAGAAATAGGAAGG - Intergenic
1078796841 11:14600714-14600736 GAGGGCGAGCAGAAACAGGGTGG - Intronic
1078809509 11:14743856-14743878 GAGGGCGAGCAGATGCAGGGTGG - Intronic
1078814459 11:14806004-14806026 GAGGAGGTGGAGAAATAGGAAGG + Intronic
1079714815 11:23731737-23731759 GAAGGCGAGCAGAAGCAGGGTGG + Intergenic
1079867821 11:25758137-25758159 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1079929528 11:26540808-26540830 GAGGATGTGGAGAAATAGGAAGG + Intronic
1080601150 11:33821456-33821478 GAGGGCTTTAAGAAGTAGAACGG - Intergenic
1080709982 11:34737670-34737692 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1080965703 11:37211410-37211432 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
1081095042 11:38921610-38921632 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
1081118198 11:39231917-39231939 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1081221505 11:40469226-40469248 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1081317804 11:41651379-41651401 GAGGGCGAGAAGAAGCAGGGTGG - Intergenic
1081958972 11:47119427-47119449 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
1082876400 11:57992971-57992993 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1083064988 11:59915181-59915203 GAGGTCATGCAGGAGTAGGGTGG - Intergenic
1083086109 11:60147519-60147541 GAGGGCTTTCAGAGGTTGGAGGG + Intergenic
1083385607 11:62306956-62306978 GAGGGTGAGCTGAAGTAGGGTGG - Intergenic
1083497023 11:63064401-63064423 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1083499097 11:63087281-63087303 GAGGGCAGGCAGAAGCAGGGTGG + Intronic
1083510140 11:63201990-63202012 GAGGGTGAGCAGAAGCAGGTTGG + Intronic
1084517697 11:69645427-69645449 AAGGGTGTGCAGTAGTGGGAAGG - Intronic
1086456913 11:86968064-86968086 GAGGGTGAGCCGAAGTAGGGTGG - Intergenic
1086907403 11:92433528-92433550 GAGGGTGAGCAAAAGTAGGGTGG - Intronic
1088078379 11:105879186-105879208 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1088702462 11:112425917-112425939 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1088871576 11:113894654-113894676 GAGGGAGTGCAGAAGAGGAACGG - Intergenic
1088885945 11:114006747-114006769 GAGGTCCTATAGAAGTAGGATGG - Intergenic
1089454028 11:118615419-118615441 GAGGGCGGGCAGAAGCTGAAAGG - Intronic
1089766113 11:120766748-120766770 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1089768027 11:120782698-120782720 TAGGGGGTGCTGAAGCAGGAGGG + Intronic
1090149075 11:124362883-124362905 GAGGACGTGGAGAAATAGGAAGG + Intergenic
1090720326 11:129466893-129466915 GAGGGCGGGCAGAAGCAGGGTGG + Intergenic
1090811620 11:130249640-130249662 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1091213613 11:133885545-133885567 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1091305244 11:134532251-134532273 GAGGGAGTGAGGAATTAGGAAGG + Intergenic
1202808764 11_KI270721v1_random:18613-18635 GAAGGAGTGGAGAAGCAGGAAGG - Intergenic
1091386418 12:98856-98878 GAGGGCGTGCAGAAGTAGGAAGG + Intronic
1092091713 12:5809129-5809151 GAGGGAGTGCAGATGGGGGAAGG + Intronic
1092304277 12:7283398-7283420 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1092398876 12:8154208-8154230 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1092440320 12:8495749-8495771 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1092567777 12:9686143-9686165 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1092637479 12:10467195-10467217 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1092911973 12:13153505-13153527 GCGGGCCTGCAGAAGCAGGAGGG + Intergenic
1092960652 12:13594036-13594058 GAGGATGTGGAGAAATAGGAAGG + Intronic
1093992927 12:25610310-25610332 GAGGGCAAGCTGAAGCAGGACGG - Intronic
1094113111 12:26882349-26882371 CAGGGTGTGGAGAAGAAGGAAGG + Intergenic
1095230579 12:39734203-39734225 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1095356334 12:41280059-41280081 GAGGGCGAGCAGAAGCAGGGTGG + Intronic
1095831545 12:46591964-46591986 GAGGGCTAGCAGAAGCAGGGTGG - Intergenic
1095867435 12:46988005-46988027 GAGGCTGTGGAGAAATAGGAAGG + Intergenic
1095920699 12:47526870-47526892 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1096218117 12:49809485-49809507 GAGGGTGGGCAGCTGTAGGAAGG + Intronic
1097166601 12:57089439-57089461 GAGGACGTGGGGAAGCAGGACGG + Intronic
1097311608 12:58124963-58124985 GAGGATGTGGAGAAATAGGAAGG - Intergenic
1097613603 12:61857762-61857784 GAGGAGGTGCAGGAGAAGGAGGG - Intronic
1097700968 12:62819946-62819968 GAGGGCGAGCCGAAGCAGGGTGG + Intronic
1097749549 12:63337031-63337053 GAGGGCAAGCTGAAGTAGGGTGG + Intergenic
1099071449 12:78049504-78049526 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1099216608 12:79861482-79861504 GAGGGCGAGCTGAAGCAGGGCGG + Intronic
1099239015 12:80116345-80116367 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1099253801 12:80290186-80290208 GAGGGTGAGCAGAAGCAGGGCGG - Intronic
1099540227 12:83899032-83899054 GAGGATGTGGAGAAATAGGAAGG - Intergenic
1099745056 12:86690608-86690630 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1100768822 12:97898597-97898619 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1100900758 12:99238069-99238091 GAGGGCGAGCTGAAGCAGGGCGG + Intronic
1101299526 12:103464203-103464225 GAGGCTGTGGAGAAATAGGAAGG - Intronic
1103169238 12:118799447-118799469 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1104490566 12:129190063-129190085 GACGGCCTGCAGATGGAGGAAGG + Intronic
1106042063 13:26103094-26103116 GAGGGCAAGCAGAAGCAGGATGG + Intergenic
1106336667 13:28789462-28789484 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1106429339 13:29665429-29665451 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1106638565 13:31558289-31558311 AAGAGGGTGCAGAAGTAGCAGGG + Intergenic
1106765435 13:32908824-32908846 GAGGGAGGGAAGAAGTAAGATGG - Intergenic
1106874309 13:34055080-34055102 GAGGGTGAGCAGAAGCAGAATGG - Intergenic
1107473538 13:40713148-40713170 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1107888797 13:44896286-44896308 GAGGGCGGGAGGAAGGAGGATGG - Intergenic
1108153684 13:47563754-47563776 GAGGGCGAGCCAAAGCAGGATGG + Intergenic
1108234961 13:48394097-48394119 GAGGGCAAGCTGAAGCAGGATGG + Intronic
1108274018 13:48789764-48789786 GAGGGCAGGAAGAAGGAGGAAGG + Intergenic
1108304519 13:49118200-49118222 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1108850197 13:54718706-54718728 GAGGACGAGCAGAAGCAGGGTGG - Intergenic
1108940488 13:55947500-55947522 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1109195846 13:59376967-59376989 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1109293661 13:60504784-60504806 GAGGGCGAGCAGAAGCAGAGTGG + Intronic
1109328575 13:60900180-60900202 GAGGGCGAGCAGAGGAAGGGTGG + Intergenic
1109457570 13:62612017-62612039 GAGGGTGAGCAGAAGCAGGGAGG - Intergenic
1109661682 13:65467716-65467738 GAGGGCGAGCAGAAGCAGAGCGG - Intergenic
1110019873 13:70457150-70457172 GAGGGCGAGCAGATGCAGGGTGG + Intergenic
1110287007 13:73761524-73761546 AAGGGCGTGCAATTGTAGGAAGG - Intronic
1110737234 13:78951372-78951394 GAGGGTGAGCAGAAGTTGGGTGG - Intergenic
1110824598 13:79957955-79957977 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1110968689 13:81733369-81733391 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1111296861 13:86290484-86290506 GAGGATGTGGAGAAATAGGAAGG - Intergenic
1112166337 13:96924222-96924244 GAGGATGTGGAGAAATAGGAAGG + Intergenic
1112412091 13:99173291-99173313 GAGGGCGAGCTGAAGCAGGGCGG - Intergenic
1113222699 13:108123238-108123260 GAGGGAGAGCAGATGGAGGAAGG + Intergenic
1113271270 13:108677129-108677151 GGGGATGTGCAGAAGGAGGAGGG + Intronic
1113652202 13:112041975-112041997 GAGGTCATGCTGGAGTAGGAAGG + Intergenic
1114603554 14:23976466-23976488 GAGGATGTGGAGAAATAGGAAGG + Intronic
1114608566 14:24019240-24019262 GAGGATGTGGAGAAATAGGAAGG + Intergenic
1114609728 14:24031213-24031235 GAGGATGTGGAGAAGTAGGAAGG + Intergenic
1114741672 14:25104411-25104433 GAGGGCGGGCAGAAGCAGGGTGG + Intergenic
1114844817 14:26308758-26308780 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1115336051 14:32245209-32245231 GAGGGCCTCCTGGAGTAGGATGG + Intergenic
1115357083 14:32460429-32460451 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1115501654 14:34055087-34055109 GAGGGCATGGAGAAGTGGAAGGG + Intronic
1115940422 14:38602126-38602148 GAGGGCGAGCCGAAGCAGGGTGG - Intergenic
1115974491 14:38981488-38981510 GAGGGCGAGCAGAAGCAAGGTGG - Intergenic
1116272848 14:42794770-42794792 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1116433680 14:44873929-44873951 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1116565323 14:46438329-46438351 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1117104184 14:52381982-52382004 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1117120976 14:52568149-52568171 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1117850145 14:59958904-59958926 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1117900674 14:60529262-60529284 GAGGGCGAGCTGAAGCAGGGCGG - Intergenic
1118516178 14:66530754-66530776 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1119930610 14:78542660-78542682 GAGGGCAAGCTGAAGTAGGGTGG - Intronic
1121091599 14:91186822-91186844 GAGGTAGTCCAGATGTAGGAGGG - Intronic
1122443403 14:101750223-101750245 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1123197977 14:106635248-106635270 GAGGGTGTGCAGAATTAGACAGG - Intergenic
1202842375 14_GL000009v2_random:133789-133811 GAGAGTGTGGAGAAATAGGAAGG - Intergenic
1202911760 14_GL000194v1_random:124030-124052 GAGAGTGTGGAGAAATAGGAAGG - Intergenic
1202880854 14_KI270722v1_random:58600-58622 GAGGGTGTGGAGAAATAGGAAGG + Intergenic
1125106978 15:35983024-35983046 GAGAGCCTGCAGAAATAGGAAGG + Intergenic
1125784210 15:42301206-42301228 GAGGGCGAGCCGAAGCAGGGTGG + Intronic
1125829408 15:42703301-42703323 GAGGGAGTGCAGAATGAGAACGG - Intronic
1125984678 15:44038699-44038721 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1126142276 15:45448362-45448384 GAGGGCGTCCAGCAGTGTGATGG + Intronic
1127137968 15:55944158-55944180 GAGGGCAAGCCGAAGCAGGATGG + Intronic
1127293603 15:57591610-57591632 GAGGGCGTGCAGAGGCTGTAGGG + Intergenic
1127452608 15:59131474-59131496 GAGGGCGAGCAGAAGTAGGGTGG + Intergenic
1128857595 15:71032273-71032295 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1129297532 15:74608178-74608200 GAGGGGGTGGAGAAGAAGGTGGG + Intronic
1130273946 15:82466812-82466834 GGGGCCCTGCAGAAGGAGGATGG + Intergenic
1130466294 15:84194186-84194208 GGGGCCCTGCAGAAGGAGGATGG + Intergenic
1130497970 15:84479350-84479372 GGGGCCCTGCAGAAGGAGGATGG - Intergenic
1130588588 15:85198779-85198801 GGGGCCCTGCAGAAGGAGGATGG + Intergenic
1130848792 15:87773389-87773411 GAGGCTGTGGAGAAATAGGAAGG + Intergenic
1131458206 15:92599588-92599610 GAGGGTGTGTAGAAATGGGATGG + Intergenic
1132803766 16:1766441-1766463 GAAGGCTTGCAGAGGTGGGAAGG + Intronic
1133345321 16:5065965-5065987 GAGGGCGTGCAGAGGCAGTCTGG - Exonic
1133409954 16:5559833-5559855 GTGAGCTTGCAGAAGTAGGCAGG - Intergenic
1133740023 16:8644378-8644400 GCTGTCGTGCAGATGTAGGAAGG + Intronic
1135052900 16:19206805-19206827 GAGGTCGTACAGGAGTAGGGTGG - Intronic
1136284781 16:29234323-29234345 GAGGTCGTGCTGGAGTAGGGTGG - Intergenic
1136381857 16:29899629-29899651 GAGGAAGTGCAGATGGAGGAGGG + Intergenic
1136454352 16:30371880-30371902 GAGGGCGTTTAGAAGTTGGAAGG - Intronic
1137460975 16:48662975-48662997 GAGGATGTGGAGAAATAGGAAGG - Intergenic
1137824535 16:51479880-51479902 GAGGATGTGGAGAAATAGGAAGG - Intergenic
1138151468 16:54661507-54661529 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1138843739 16:60539567-60539589 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1138886830 16:61090613-61090635 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1139222146 16:65194541-65194563 GAGGGCGAGCAGAAGAAGGGTGG - Intergenic
1140165154 16:72543351-72543373 GAGGGCGAGCGGAAGCAGGGTGG + Intergenic
1140627982 16:76817832-76817854 CAGGGCGGGCAGAAGTGGGGAGG - Intergenic
1141225814 16:82113881-82113903 GAGGGCATACAGGAGTAGGGTGG - Intergenic
1142362237 16:89632941-89632963 GAGGGGCTGCAGGAGGAGGAGGG + Intronic
1142924145 17:3218281-3218303 GAGGATGTGGAGAAATAGGAAGG + Intergenic
1143732865 17:8890792-8890814 GAAGGCGTGCAGGAGCAGGGTGG + Exonic
1144434202 17:15224397-15224419 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1145836236 17:27956391-27956413 GAGGGCTTGCAGAATCAGGCAGG - Intergenic
1146746419 17:35334220-35334242 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1149139427 17:53412550-53412572 GAGGATGTGGAGAAATAGGAAGG + Intergenic
1149168238 17:53779838-53779860 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1149240633 17:54644712-54644734 GAGGATGTGAAGAAATAGGAAGG + Intergenic
1149281358 17:55108703-55108725 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1149365373 17:55938837-55938859 GAGGGTGAGCAGAAGCAGGTTGG + Intergenic
1149592450 17:57841482-57841504 GCTGGGGTGCAGAAGTGGGAGGG - Intronic
1149865476 17:60149005-60149027 GAGGACCTGCAGTAGCAGGAGGG + Intergenic
1149932094 17:60767167-60767189 GAGGGCGAGCCGAAGCAGGGTGG - Intronic
1150025802 17:61673194-61673216 GAGGGCGAGCCGAAGCAGGGTGG + Intergenic
1150545690 17:66155236-66155258 GAGGGCGAGCCGAAGCAGGGTGG + Intronic
1150884543 17:69070438-69070460 GAGGGGGAGCAGAAGCAGGGTGG + Intergenic
1151055320 17:71023930-71023952 GTGGGAGTGCAGAAGGAGCACGG - Intergenic
1151495944 17:74458166-74458188 GAGGAAGTGCAGAAGTCGGCTGG - Intergenic
1151878641 17:76881473-76881495 GAGGCCGGGCAGGAGAAGGAGGG + Intronic
1151953008 17:77365631-77365653 GAGCGGGTGCAGAAGAGGGAGGG + Intronic
1152132505 17:78485564-78485586 GAGGTCGTGTAGAAGTTGAAGGG + Exonic
1152187077 17:78864266-78864288 GAGGGAGGGAAGAAGAAGGAAGG - Intronic
1153072678 18:1123913-1123935 GAGGATGTGGAGAAATAGGAAGG - Intergenic
1153119114 18:1700113-1700135 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1153313495 18:3700418-3700440 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
1153717933 18:7869491-7869513 GAGGGAGAGCAGAAGCAGGGTGG - Intronic
1153743381 18:8151951-8151973 GAGGGCGAGCCGAAGCAGGGTGG - Intronic
1153798378 18:8646574-8646596 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1155161647 18:23201041-23201063 CAGGGAGAGCAGAAGCAGGAAGG + Intronic
1155395227 18:25379923-25379945 GAGGGCGAGTAGAAGCAGGGTGG + Intergenic
1155857432 18:30850569-30850591 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1156411014 18:36828635-36828657 GAGGGTGTGGAGGAGAAGGAAGG - Intronic
1156493161 18:37508332-37508354 GAGAGCGTGCAGAGGCAGGAGGG + Intronic
1157178952 18:45478279-45478301 TAGGGCGAGCAGAAGCAGGGTGG - Intronic
1157958661 18:52127511-52127533 GAGGGCCTGCAGTATTAGCAAGG - Intergenic
1158341759 18:56473635-56473657 GATGGCCTGGAGAAGAAGGAGGG - Intergenic
1158427372 18:57352363-57352385 GAGGGGGTGCAGGAGAGGGAGGG - Exonic
1158543616 18:58378082-58378104 GAGGCTGTGCAGTAGTTGGAGGG + Intronic
1159002793 18:62988371-62988393 GGGGGTGTCCAGAAGGAGGACGG - Intergenic
1159661305 18:71098416-71098438 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1159690673 18:71483304-71483326 GAGGGCGAGCCGAAGCAGGGAGG - Intergenic
1161453298 19:4358345-4358367 GAGGGAGGGCAGAAGTTGGAGGG - Intronic
1161498357 19:4599231-4599253 GAGGGCCTGCAGAGGAAGGAAGG - Intergenic
1161999880 19:7737205-7737227 GATGACGTGAAGAGGTAGGAAGG + Intergenic
1162053089 19:8046797-8046819 GAGGGGGAGGAGAAGGAGGAGGG - Intronic
1162467138 19:10849075-10849097 GAGGGAGGGCAGGAGAAGGAAGG - Intronic
1162758463 19:12874331-12874353 CAGAGCGTGCAGACGGAGGATGG + Exonic
1163430336 19:17263481-17263503 GAGGTGGTGAAGAAGTTGGAGGG + Intronic
1163594875 19:18215225-18215247 CAGGGTGTGCAGAATGAGGAAGG - Intronic
1164047622 19:21555931-21555953 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1165254669 19:34568511-34568533 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1166317343 19:41996554-41996576 GAGGCTCTGCAGAAGTAGGGGGG + Intronic
1166858539 19:45795888-45795910 GAGGGCGAGGAGGAGGAGGAGGG - Exonic
1167727422 19:51225766-51225788 GAGGGGATGCAGAATCAGGAGGG - Intronic
1168170582 19:54585765-54585787 AAGGGCGAGCTGAAGCAGGATGG - Intronic
1168530937 19:57128061-57128083 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1202656463 1_KI270708v1_random:27707-27729 GAGAGTGTGGAGAAATAGGAAGG + Intergenic
924989029 2:295429-295451 GAGGGTGGGCAGAAGGAGGCAGG - Intergenic
925079660 2:1053972-1053994 CAGGGCCTGCAGAGGGAGGAGGG - Intronic
925363491 2:3295588-3295610 GAGGGTGTGCAGAGAGAGGAGGG - Intronic
925363510 2:3295688-3295710 GAGGGTGTGCAGAGAGAGGAGGG - Intronic
926648531 2:15316393-15316415 GAGGGCGAGATGAAGTAGGGCGG + Intronic
926970680 2:18464164-18464186 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
927182715 2:20458450-20458472 GAGGGTGAGCAGAAGCAAGATGG + Intergenic
927702236 2:25275927-25275949 GAGGGGGTGCGGAAGGAGGAGGG + Intronic
927904127 2:26845235-26845257 GAGGACGTGCTGAAGCAGGAAGG + Intergenic
928172981 2:29015288-29015310 GAGGGAGCGCAGAAGTGGGGTGG - Intronic
928750564 2:34466362-34466384 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
929256220 2:39813973-39813995 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
929333625 2:40713249-40713271 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
929837934 2:45425661-45425683 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
930223386 2:48767867-48767889 GAGGGCAGGCAGAAGCAGGGTGG - Intronic
930307382 2:49692481-49692503 GAGGCTGTGGAGAAATAGGAAGG - Intergenic
930743365 2:54856616-54856638 GATGCAGTGCAGAAGCAGGAAGG + Intronic
930951248 2:57146391-57146413 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
931212171 2:60207609-60207631 GAGGGAGAGCAGAAGCAGGGTGG - Intergenic
931839471 2:66132981-66133003 GAGGGCGAGGAGGAGCAGGATGG + Intergenic
932327972 2:70876046-70876068 GAGGGCGAGCTGAAGCAGGGCGG + Intergenic
932539925 2:72641235-72641257 GAGGGCGAGCTGAAGCAGGGCGG + Intronic
933488368 2:82950819-82950841 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
934871732 2:97872591-97872613 GAGGGCGAGCCGAAGCAGGGTGG + Intronic
935325750 2:101935514-101935536 GAGGGCGAGCTGAAGCAGGGTGG + Intergenic
936900037 2:117472340-117472362 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
937807205 2:126160627-126160649 GAGGGCAAGCTGAAGCAGGATGG + Intergenic
938144658 2:128823534-128823556 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
938198877 2:129356748-129356770 AAGGGCTTGCAGTAGAAGGAAGG - Intergenic
938224357 2:129602877-129602899 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
939180306 2:138795794-138795816 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
939382119 2:141448692-141448714 GAGGGCGAGCCGAAGCAGGGTGG - Intronic
939454898 2:142421408-142421430 GAGGGGGTGAAGTGGTAGGATGG + Intergenic
939937848 2:148313935-148313957 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
940054624 2:149500507-149500529 GAGGGAGAGCAGAAGCAGGGTGG - Intergenic
940062668 2:149589657-149589679 GAGGCCGGGTAGAGGTAGGAGGG - Intergenic
940528285 2:154844922-154844944 GAGGGCGAGCTGAAGCAGGCAGG - Intronic
940565240 2:155351827-155351849 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
940720270 2:157274458-157274480 GAGGATGTGGAGAAATAGGAAGG - Intronic
940964436 2:159821883-159821905 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
940995800 2:160148620-160148642 GAGGGTGAGCAGAAGCAGGGCGG + Intronic
941239471 2:163017909-163017931 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
941344622 2:164352292-164352314 GAGGTCATGCTGCAGTAGGATGG - Intergenic
941477963 2:165971643-165971665 GAGGGAGAGCAGAAGCAGGGTGG + Intergenic
941518799 2:166511843-166511865 GAGGGCGAACAGAAGCAGGGTGG - Intergenic
941682420 2:168413339-168413361 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
941896053 2:170630078-170630100 GAGGGCGAGCTGAAGCAGGGCGG + Intronic
942395758 2:175547777-175547799 GAGGGTCTGCATAAGCAGGAAGG - Intergenic
942431380 2:175914596-175914618 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
942458951 2:176156640-176156662 GAGGGGGCGCGGAAGAAGGAGGG - Intronic
942898673 2:181089066-181089088 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
943094803 2:183416464-183416486 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
943147767 2:184066433-184066455 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
943512237 2:188840464-188840486 GAGGGTGAGCTGAAGTAGGATGG + Intergenic
943660399 2:190554009-190554031 GAGGGCGAGCTGAAGCAGGGTGG + Intergenic
944267820 2:197748093-197748115 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
944291952 2:198018077-198018099 GAGGGCGAGCAGAAGCAGGGTGG + Intronic
944499163 2:200340572-200340594 GAGGGGGTGCAGCAGGAGGTGGG + Intronic
944634747 2:201664462-201664484 GAGGGCTTGCCGATGTAGGAGGG + Intronic
944764265 2:202848983-202849005 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
945210968 2:207381467-207381489 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
945409084 2:209488129-209488151 GAGGTCGAGCAGAAGCAGGGTGG + Intronic
945761050 2:213915749-213915771 GAGGATGTGAAGAAATAGGAAGG - Intronic
945927326 2:215819167-215819189 GAGGGCAAGCTGAAGCAGGATGG + Intergenic
945999092 2:216465857-216465879 GAGGGTGTGGAGAGGTAGGTGGG - Intronic
946324900 2:218980334-218980356 GAGGCCGAGCAGAAGAAAGACGG + Intergenic
946649099 2:221871894-221871916 GAGGGTGTGCAGAAGCAGAGTGG + Intergenic
946794029 2:223330655-223330677 GAGGGCGAGCTGAAGCAGGGCGG + Intergenic
946818933 2:223610445-223610467 GTGGGAATGCAGAAGTATGAGGG - Intergenic
946912904 2:224484978-224485000 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
947364595 2:229381118-229381140 GAGGGCGAGCAGAAGCAGGATGG + Intronic
1169421410 20:5463663-5463685 GAAGGCGAGCAGAAGCAGGGTGG - Intergenic
1169984189 20:11423418-11423440 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1170209727 20:13836607-13836629 GAGGGAGTGGAAAAGTGGGAAGG + Intergenic
1170229480 20:14028717-14028739 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1170265288 20:14460354-14460376 GAGGATGTGGAGAAATAGGAAGG - Intronic
1170270081 20:14517050-14517072 GAGGATGTGGAGAAATAGGAAGG + Intronic
1170288363 20:14737582-14737604 GAGGATGTGGAGAAATAGGAAGG - Intronic
1170291006 20:14768267-14768289 GAGGATGTGGAGAAATAGGAAGG - Intronic
1170294155 20:14806299-14806321 GAGGGCGACCAGAAGCAGGGTGG + Intronic
1171000766 20:21413672-21413694 GAGGGCGAGCCGAAGCAGGGTGG + Intergenic
1171179832 20:23084396-23084418 CAGGGCCAGCAGGAGTAGGATGG + Exonic
1171266996 20:23779610-23779632 GAGGCTGTGGAGAAATAGGAAGG - Intergenic
1171276716 20:23862385-23862407 GAGGCTGTGGAGAAATAGGAAGG - Intergenic
1171883681 20:30636167-30636189 GAGGGTGGGGGGAAGTAGGAAGG - Intergenic
1174319011 20:49725943-49725965 GAGGGTGTGAGGTAGTAGGATGG + Intergenic
1174991713 20:55518090-55518112 GAGGCTGTGGAGAAATAGGAAGG - Intergenic
1175247637 20:57591332-57591354 GAGCGTGTGAAGAAGTGGGAAGG + Intergenic
1175315525 20:58044170-58044192 GAGGGTGTGCAGCAGAGGGAGGG + Intergenic
1176631122 21:9138697-9138719 GAGAGTGTGGAGAAATAGGAAGG - Intergenic
1176891697 21:14327002-14327024 GAGGGCACGCAGAAGCAGGGTGG + Intergenic
1177184275 21:17776037-17776059 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1177842686 21:26252234-26252256 GAGGACATGCAAAAATAGGATGG - Intergenic
1178688283 21:34728747-34728769 GAGAGGGTGGAGAAGAAGGAAGG + Intergenic
1178748297 21:35274969-35274991 GAGGGAGAGCAGAAGGAGGTGGG - Intronic
1178909678 21:36664398-36664420 GAGGGGGTGCAGAAGGAAAAGGG + Intergenic
1179319773 21:40279487-40279509 GAGGATGTGGAGAAATAGGAAGG + Intronic
1179568733 21:42265385-42265407 GAGGTCATGCTGAAGTAGGGTGG + Intronic
1179725388 21:43338859-43338881 GAGGGTCTGCAGAAGCAGGCGGG + Intergenic
1179879085 21:44286080-44286102 CAGCGCGTGCAGCAGTGGGAAGG - Exonic
1180375470 22:12088906-12088928 GAGGGTGTGGAGAAATAGGAAGG + Intergenic
1180540968 22:16447367-16447389 GAGGGTGAGCTGAAGCAGGATGG + Intergenic
1180598572 22:16997272-16997294 GAGGATGTGGAGAAATAGGAAGG - Intronic
1181527342 22:23497569-23497591 GAGGGCATCCAGAGGGAGGAGGG - Intergenic
1181907336 22:26209769-26209791 GAGGGAGGGAAGAAGGAGGAAGG + Intronic
1182679024 22:32063851-32063873 GAGGGAGTCCAGAATGAGGAAGG + Intronic
1183097976 22:35565749-35565771 GAGGGGGAGGAGAAGTTGGAGGG - Intergenic
1183182799 22:36272175-36272197 GAGGGCGAGCAGAATCAGGGTGG - Intergenic
1183404842 22:37625295-37625317 GAGGACAGGCAGAAGAAGGAAGG + Intronic
1183579494 22:38715424-38715446 CTGGGCCTGCAGAAGGAGGAAGG - Intronic
1184340870 22:43885248-43885270 GAGGACGTGCAGAAATGGGCGGG - Intronic
1185187645 22:49412180-49412202 GAGGGAGTGGAGGAGGAGGAGGG + Intergenic
949423601 3:3891902-3891924 GAGGATGTGCTGAAGCAGGATGG - Intronic
949456671 3:4246232-4246254 GAGGGTGAGCAGAAGCAGGGCGG - Intronic
949632613 3:5944545-5944567 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
949954967 3:9259995-9260017 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
950991945 3:17449082-17449104 GAGGGTGAGCAGAAGCAGCATGG + Intronic
951026844 3:17839854-17839876 GGGAGCGTCCAGATGTAGGAGGG + Intronic
951205942 3:19926073-19926095 CAGGGCCTGCATAACTAGGAAGG + Intronic
951254582 3:20433409-20433431 GAGGACGAGCAGAAGCAGGGTGG - Intergenic
951320920 3:21244227-21244249 GAGGATGTGGAGAAATAGGAAGG - Intergenic
951347322 3:21561441-21561463 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
951629196 3:24699764-24699786 GAGGGAGAGCAGAAGCAGGGTGG - Intergenic
951741600 3:25931326-25931348 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
951826584 3:26875657-26875679 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
952864448 3:37843705-37843727 GAGGACGTGGAGAAATAGGAAGG + Intergenic
953555867 3:43946353-43946375 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
954501035 3:51014137-51014159 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
954510577 3:51121287-51121309 GAGGGCGAGCAGAAGCAGAGTGG - Intronic
954524862 3:51261260-51261282 GAGGGCAAGCAGAAGGAGGGTGG + Intronic
954571891 3:51647967-51647989 GAGGGCGAGCCGAAGCAGGGTGG + Intronic
955089886 3:55739388-55739410 GAGGATGTGGAGAAATAGGAAGG - Intronic
955503931 3:59612497-59612519 GTGGGAGTCAAGAAGTAGGAGGG - Intergenic
956207803 3:66772117-66772139 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
956396089 3:68827514-68827536 GAGGATGTGGAGAAATAGGAAGG - Intronic
956460427 3:69466021-69466043 GAGGATGTGGAGAAATAGGAAGG - Intronic
956570728 3:70691377-70691399 GAGGATGTGGAGAAGTAGGAAGG - Intergenic
957011353 3:75009190-75009212 GAGGGCCAGCAGAAGCAGGGTGG - Intergenic
957699551 3:83690789-83690811 GAGGATGTGGAGAAATAGGAAGG + Intergenic
957747757 3:84366595-84366617 GAGGGCCAGCAGAAGCAGGGTGG - Intergenic
957850514 3:85800702-85800724 GAGGGCGAGCAGAAGTAGGGTGG - Intronic
958422774 3:93947179-93947201 GAGGATGTGGAGAAATAGGAAGG + Intronic
958434615 3:94081204-94081226 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
959170878 3:102842260-102842282 GAGGGCGAGCCAAAGTAGGGTGG - Intergenic
959345664 3:105191471-105191493 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
959453689 3:106533909-106533931 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
959534526 3:107470203-107470225 GAGGGTGAGCAGAAGAAGGGTGG + Intergenic
959736433 3:109664888-109664910 GAGGGTGTGCTGAAGCAGGGCGG + Intergenic
960655890 3:120003917-120003939 GAGGGCGAGCCGAAGCAGGGTGG + Intronic
960773236 3:121217477-121217499 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
960836098 3:121908354-121908376 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
960845706 3:122002761-122002783 GAGGGTGTGGGGATGTAGGAGGG - Intronic
961977431 3:131041947-131041969 GAGGGCGAGCAGAAGGAGGGTGG + Intronic
962156763 3:132956549-132956571 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
962634856 3:137319879-137319901 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
962642063 3:137398022-137398044 GAGGATGTGGAGAAATAGGAAGG + Intergenic
963048531 3:141122914-141122936 GAGGGCAAGCGGAAGCAGGACGG - Intronic
963410933 3:144926793-144926815 GAGGGCGAACAGAAGCAGGGTGG - Intergenic
963629376 3:147713457-147713479 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
963689752 3:148483647-148483669 GAGGATGTGGAGAAATAGGAAGG + Intergenic
963691155 3:148504494-148504516 GAGGATGTGGAGAAATAGGAAGG - Intergenic
963998639 3:151740288-151740310 GAGGGCGAACAGAAGCAGGGTGG - Intronic
964128883 3:153265841-153265863 GAGGCTGTGGAGAAATAGGAAGG + Intergenic
964245649 3:154649730-154649752 GAGGATGTGGAGAAATAGGAAGG + Intergenic
964390781 3:156195414-156195436 GAGGATGTGGAGAAATAGGAAGG - Intronic
964391325 3:156201110-156201132 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
965091161 3:164163727-164163749 GAGGGCTAGCAGAAGCAGGGTGG - Intergenic
965511024 3:169568065-169568087 GAGGGTGAGCAGAAGCAGGATGG + Intronic
966250997 3:177865570-177865592 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
966309322 3:178576191-178576213 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
966560961 3:181319884-181319906 GAGGATGTGGAGAAATAGGAAGG - Intergenic
967419653 3:189259293-189259315 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
967715503 3:192757902-192757924 GAGGGAGAGCAGAAGCAGGGTGG + Intronic
967864927 3:194182255-194182277 GAAGAAGAGCAGAAGTAGGAGGG - Intergenic
968692726 4:2003240-2003262 GAGGCTGTGGAGAAATAGGAAGG + Intronic
969817906 4:9699662-9699684 GAGGGCTTGCGGCAGCAGGAGGG + Intergenic
970214605 4:13745665-13745687 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
970679290 4:18489024-18489046 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
970714643 4:18907607-18907629 GAGGGCTAGCAGAAGCAGGGTGG + Intergenic
970939685 4:21616796-21616818 GAGGCCATACTGAAGTAGGATGG - Intronic
971330384 4:25676808-25676830 GAAAGGGTGCAGAAGTGGGAGGG - Exonic
971642009 4:29146334-29146356 GAGGATGTGGAGAAATAGGAAGG - Intergenic
971749121 4:30623873-30623895 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
972260945 4:37407878-37407900 GAGGGCGAGCAGAAGCAGGATGG + Intronic
972372531 4:38438493-38438515 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
972962661 4:44473557-44473579 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
973016286 4:45142833-45142855 GAGGGAGTGAAGCAGTTGGAAGG - Intergenic
973367337 4:49218438-49218460 GAGGGTGGGGGGAAGTAGGAAGG - Intergenic
973629023 4:52801797-52801819 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
974251862 4:59394798-59394820 GAGGGCCAGCAGAAGCAGGTTGG - Intergenic
974264060 4:59560900-59560922 GAGGGCAAGCAGAAGCAGGTGGG - Intergenic
974871714 4:67652696-67652718 GAGGGCGAGCCGAAGCAGGGCGG + Intronic
975291705 4:72685094-72685116 GAGGATGTGGAGAAATAGGAAGG + Intergenic
975350503 4:73340340-73340362 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
975365003 4:73518808-73518830 GAGGGTGAGCCAAAGTAGGATGG - Intergenic
975466418 4:74714252-74714274 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
975524168 4:75331146-75331168 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
975638700 4:76477821-76477843 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
976362981 4:84202471-84202493 GAGGGCCAGCAGAAGCAGGATGG + Intergenic
976394823 4:84544798-84544820 GAGGGCGAGCTGAAGCAGGGTGG + Intergenic
977326009 4:95575510-95575532 GAGGATGTGGAGAAATAGGAAGG - Intergenic
977744368 4:100528002-100528024 GAGGATGTGGAGAAATAGGAAGG - Intronic
977771756 4:100868776-100868798 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
977792852 4:101128592-101128614 GAGGGCAAGCAGAAGCAGGGCGG + Intronic
977815850 4:101413099-101413121 GAGGCTGTGGAGAAATAGGAAGG + Intronic
977986085 4:103385240-103385262 GAGGGCGAGCCGAAGCAGGGTGG + Intergenic
978078964 4:104568444-104568466 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
978237004 4:106471875-106471897 GAGGGCGAGCAGAAACAGGGTGG - Intergenic
978664213 4:111163875-111163897 GAGGGAGAGCGGAAGTAGGGAGG + Intergenic
979012248 4:115387092-115387114 GAGGGTGAGCAGAAGTAGGGTGG + Intergenic
979462731 4:121001984-121002006 GAGGGCGAGCCAAAGCAGGATGG - Intergenic
979501486 4:121445604-121445626 GAGGATGTGGAGAAATAGGAAGG + Intergenic
979668362 4:123336990-123337012 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
980037856 4:127905474-127905496 GAGGGCGAGCCAAAGCAGGATGG - Intergenic
980157718 4:129126815-129126837 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
980285764 4:130776880-130776902 GAGGGCGAGCCGAAGTAGGGTGG + Intergenic
980422406 4:132580597-132580619 GGGAGGGTGTAGAAGTAGGAAGG - Intergenic
980494243 4:133570584-133570606 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
980634009 4:135474256-135474278 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
980769254 4:137350722-137350744 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
980888224 4:138786034-138786056 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
981414961 4:144482607-144482629 GAGGGCGAGCCGAAGCAGGGAGG + Intergenic
982563588 4:156961801-156961823 GATGGCGTGCAGAATGAGGCTGG - Intronic
982794622 4:159630013-159630035 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
982815468 4:159878220-159878242 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
982825655 4:160001498-160001520 GAGGGTGAGCAGAAGTAGGGTGG + Intergenic
982915498 4:161203793-161203815 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
983044602 4:162970167-162970189 GAGGGCCAGCAGAAGCAGGGTGG - Intergenic
983047563 4:163005016-163005038 GAGGGCAAGCCGAAGCAGGATGG - Intergenic
983388112 4:167092138-167092160 GAGGGCAAGCTGAAGTAGGGTGG + Intronic
983485985 4:168331645-168331667 GAAGGCGAGCAGAAGCAGGGTGG - Intergenic
983543207 4:168935121-168935143 GAGGGCGAGCAGAAGCAGGGTGG + Intronic
983596390 4:169472430-169472452 GAGGGAGAGCAGAAGCAGGGTGG - Intronic
983602834 4:169549253-169549275 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
983840777 4:172455059-172455081 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
984526142 4:180861031-180861053 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
985126697 4:186701704-186701726 GAGGACGTGCAGCAGGAGCAGGG + Intronic
1202757066 4_GL000008v2_random:74348-74370 GAGGGTGTGGAGAAATAGGAAGG + Intergenic
985497861 5:219674-219696 GAGGGCGTCCACAAGCAGGAAGG + Intronic
985652281 5:1112560-1112582 GAGGGGGCGCAGAAGGAGGAGGG - Intergenic
986323115 5:6649729-6649751 GAGGGCGAGCCGAAGCAGGGTGG - Intronic
986358458 5:6951964-6951986 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
986487630 5:8255102-8255124 GAGGGGGTGAAGAGGAAGGAAGG + Intergenic
986675110 5:10177546-10177568 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
988084472 5:26457581-26457603 GAGGATGTGGAGAAATAGGAAGG - Intergenic
988402023 5:30775282-30775304 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
988618130 5:32794853-32794875 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
988687575 5:33539978-33540000 GAGGGCGAGCGGAAGCAGGGCGG + Intronic
988719121 5:33858855-33858877 GAAGGCAAGCAGAAGCAGGATGG + Intronic
989349957 5:40474727-40474749 GAGGGTGAGCTGAAGTAGGGTGG - Intergenic
989358114 5:40567359-40567381 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
989451878 5:41596466-41596488 GAGGGTGAGCTGAAGCAGGATGG + Intergenic
990536805 5:56731368-56731390 GAGGATGTGGAGAAATAGGAAGG + Intergenic
990728907 5:58786897-58786919 CAGCGCGTCCAGAAGTAGAAAGG + Intronic
990745941 5:58959380-58959402 GAGGGCGAGCCGAAGGAGGGTGG - Intergenic
990803426 5:59631592-59631614 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
992055213 5:72982205-72982227 GAGAGCGAGCAGAAGCAGGACGG - Intronic
992077767 5:73206913-73206935 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
992254971 5:74912065-74912087 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
992287207 5:75247990-75248012 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
992383936 5:76265769-76265791 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
992740702 5:79770583-79770605 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
993145327 5:84086448-84086470 GAGAGCGAGCAGAAGCAGGGTGG - Intronic
993357831 5:86936979-86937001 GAGGATGTGGAGAAATAGGAAGG - Intergenic
993402602 5:87472475-87472497 AAGGGCGAGCAGAAGCAGGGCGG + Intergenic
993961046 5:94296698-94296720 GAGGGCAAGCAGAAGTGGGGAGG - Intronic
994005247 5:94829263-94829285 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
994014963 5:94955109-94955131 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
994260972 5:97658425-97658447 GAGGGCCTGGAGAGGAAGGAGGG - Intergenic
994345891 5:98685751-98685773 GAGGATGTGAAGAAATAGGAAGG + Intergenic
994641872 5:102420963-102420985 GAGGCCGAGCAGAAGCAGGGTGG + Intronic
995162585 5:108998444-108998466 GAGGGCGAGCCGAAGAAGGATGG - Intronic
995263860 5:110136247-110136269 GAGGGTGAGCAGAAGCAGGCTGG - Intergenic
995464339 5:112435843-112435865 GAGGGTGAGCAGAAGCAGGCTGG + Intergenic
995643014 5:114278841-114278863 GAGGGTGAGCTGAAGTAGGGCGG - Intergenic
996109835 5:119552312-119552334 GAGGCTGTGGAGAAATAGGAAGG - Intronic
996280824 5:121727023-121727045 TAGGGCGAGCAGAAGCAGGTTGG - Intergenic
996316104 5:122162690-122162712 GTGGGGGTGCAGAGGTAGGGAGG - Intronic
996428000 5:123335642-123335664 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
996910963 5:128656268-128656290 GAGGGGGAGCAGAAGCAGGATGG - Intronic
997338367 5:133123450-133123472 GAGCTCATGCAGAAGTAGAAAGG + Intergenic
997497070 5:134337325-134337347 GAGGGCGAGCCGAAGCAGGGAGG - Intronic
997809608 5:136954339-136954361 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
998598765 5:143562633-143562655 AAGCACGTGGAGAAGTAGGAGGG - Intergenic
998842609 5:146271553-146271575 GAGGGCGTGGAGGAAGAGGAAGG + Exonic
1000052024 5:157571682-157571704 GAGTGAGAGCAGAAGCAGGAAGG + Intronic
1000194858 5:158947487-158947509 GAGGGCGAGCAGAAGCAGGACGG - Intronic
1000214785 5:159145049-159145071 GAGGATGTGGAGAAATAGGAAGG + Intergenic
1000284211 5:159812638-159812660 GAGGATGTGGAGAAATAGGAAGG + Intergenic
1000547977 5:162625556-162625578 GAGGGCTAGCAGAAGCAGGGTGG + Intergenic
1000574791 5:162964661-162964683 GAGGGTGAGCTGAAGCAGGATGG - Intergenic
1001121750 5:168986545-168986567 GAGAGCGTGCAGGGGTGGGATGG - Intronic
1001362757 5:171103898-171103920 GAGGGCGAGCCGAAGAAGGGTGG - Intronic
1002651813 5:180703259-180703281 GAGGATGTGGAGAAATAGGAAGG + Intergenic
1002723539 5:181280646-181280668 AAGAGCGTGCAGAAGAGGGAGGG - Intergenic
1003434444 6:6072715-6072737 GAGGGTGAGCTGAAGTAGGGTGG - Intergenic
1003647463 6:7925842-7925864 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1003872797 6:10415170-10415192 GAGGGCGAGGAGGAGGAGGAGGG + Exonic
1003971486 6:11304318-11304340 GAGGATGTGGAGAAATAGGAAGG + Intronic
1004751372 6:18565772-18565794 GAGGGAGGGAAGAAGAAGGAGGG - Intergenic
1005778437 6:29162307-29162329 GAGGGCAAGCAGAAGAAGGGTGG - Intergenic
1005796309 6:29365666-29365688 GAGGATGTGGAGAAATAGGAAGG + Intronic
1005846791 6:29787814-29787836 GAGGTTGTGGAGAAATAGGAAGG + Intergenic
1006199875 6:32279056-32279078 GAGGGTGAGCAGAAGTGGGGTGG + Intergenic
1007509381 6:42363678-42363700 GAGGTCCTACTGAAGTAGGATGG + Intronic
1008407676 6:51136734-51136756 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
1008865334 6:56203812-56203834 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1008896920 6:56566493-56566515 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1009037090 6:58130607-58130629 GAGGATGTGGAGAAATAGGAAGG - Intergenic
1009264031 6:61531638-61531660 GAGGGCAAGCTGAAGCAGGATGG + Intergenic
1009305982 6:62089522-62089544 GAGGGCGAGCAGAAGGAGGGTGG - Intronic
1009455181 6:63848530-63848552 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
1009718335 6:67428676-67428698 GAGGGCGAACAGAAGCAGGATGG - Intergenic
1009724183 6:67515149-67515171 GAGGATGTGGAGAAATAGGAAGG + Intergenic
1009775822 6:68205455-68205477 GAGGGCCAGCAGAAGCAGGGTGG + Intergenic
1009860383 6:69322481-69322503 GAGGTTGTGCAGAAAAAGGAAGG - Intronic
1009862002 6:69346715-69346737 GAGGATGTGGAGAAATAGGAAGG + Intronic
1009880428 6:69560310-69560332 GAGGGCGAGCAGAAGCAGGTTGG + Intergenic
1010355681 6:74930024-74930046 GAGGAAGAGGAGAAGTAGGAAGG + Intergenic
1010467551 6:76186740-76186762 GAGGATGTGGAGAAATAGGAAGG - Intergenic
1010574870 6:77518357-77518379 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1010615280 6:78005471-78005493 GAGGGCAAGCAGAAGTAGGGTGG + Intergenic
1010668392 6:78656100-78656122 GAGGGCGAGCAGAAGCAGCGTGG - Intergenic
1010755724 6:79664138-79664160 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
1010952213 6:82050155-82050177 GAGAAAGAGCAGAAGTAGGAAGG - Intergenic
1010961486 6:82151063-82151085 GAGGGCGAGCTGAAGCAGGGCGG + Intergenic
1011120005 6:83942319-83942341 GAGGGCGAGCAGAAGCATGGTGG + Intronic
1011235656 6:85213452-85213474 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1011301522 6:85879201-85879223 GAGGGCAAGCGGAAGTAGGGTGG - Intergenic
1011713868 6:90084111-90084133 GAGGGGGTGGGGAAGTATGAAGG + Intronic
1011831315 6:91374987-91375009 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1012128011 6:95454542-95454564 GAAGGCGAGCAGAAGCAGGGTGG - Intergenic
1012585289 6:100914105-100914127 GAGGGCGAGCTGAAGCAGGGCGG - Intergenic
1012591899 6:100992252-100992274 GAGGATGTGGAGAAATAGGAAGG + Intergenic
1012850203 6:104437642-104437664 GAGGGCGTGCACGAACAGGAGGG - Intergenic
1012870803 6:104670927-104670949 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1013452903 6:110303008-110303030 GAGGGCGAGCAGAAGTAGGGTGG + Intronic
1013682506 6:112541095-112541117 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1013920239 6:115394892-115394914 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1013939506 6:115644994-115645016 GAGTGCGAGCAGAAGCAGGGTGG + Intergenic
1014527905 6:122522706-122522728 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1014584523 6:123182301-123182323 GATGGCGAGCAGAAGCAGGGTGG + Intergenic
1015533532 6:134244610-134244632 GAGGGCGAGCAGAAGCAGGTGGG - Intronic
1015623484 6:135156631-135156653 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1016111383 6:140229983-140230005 GAGGGCGAGCCGAAGCAGGATGG + Intergenic
1016487843 6:144562832-144562854 GAGGCTGTGGAGAAATAGGAAGG - Intronic
1016730808 6:147425567-147425589 GAGGATGTGGAGAAGTAGGAAGG - Intergenic
1017357039 6:153521464-153521486 GAGGGTGAGCTGAAGCAGGAGGG - Intergenic
1017573445 6:155773809-155773831 GAGGCTGTGGAGAAATAGGAAGG - Intergenic
1018805715 6:167258152-167258174 GAGGGGGAGCAGAAGCAGGGTGG + Intergenic
1018844711 6:167547517-167547539 GATGGGGTGAAGAAGGAGGAGGG - Intergenic
1019427764 7:985370-985392 ATGGGCGTGCAGCAGGAGGACGG + Intronic
1020390909 7:7656944-7656966 GAGGATGTGTAGAAATAGGAAGG - Intronic
1020525739 7:9256357-9256379 GAGGCTGTGGAGAAATAGGAAGG + Intergenic
1020609049 7:10372700-10372722 GAGGGCAAGCTGAAGTAGGGAGG + Intergenic
1020629666 7:10625214-10625236 GAGGGCGAGCAGAAGCAGAGGGG + Intergenic
1020715974 7:11675113-11675135 GAGGGCAAGCAGAAGCAGGTGGG + Intronic
1020823930 7:13003261-13003283 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1021071607 7:16248734-16248756 GAGGGCGAGCTGAAGAAGGGTGG + Intronic
1021207772 7:17806802-17806824 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1021347751 7:19548540-19548562 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1021920337 7:25478719-25478741 GAGGGAGGACAGATGTAGGAAGG + Intergenic
1022038013 7:26552253-26552275 GAGGGAGTGCAGAGGAGGGATGG + Intergenic
1022058930 7:26770750-26770772 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1022558857 7:31328183-31328205 GAGGGTGTGGAGAAATAGGAAGG - Intergenic
1023051841 7:36259139-36259161 GAGGGCGAGCTGAACCAGGATGG - Intronic
1023511707 7:40959969-40959991 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1023561100 7:41474148-41474170 GAGGTGGAGCAGATGTAGGAGGG - Intergenic
1023692221 7:42801691-42801713 GAGGATGTGGAGAAATAGGAAGG + Intergenic
1023760690 7:43462656-43462678 GAGGGCGCCCTGCAGTAGGATGG - Intronic
1023894230 7:44418771-44418793 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1024017643 7:45332692-45332714 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1024664993 7:51537073-51537095 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1025111037 7:56216411-56216433 GAAGGGTTGCAGAAGGAGGAGGG + Intergenic
1025638006 7:63340408-63340430 GAGGGCGAGCAGAAGCAGGTTGG - Intergenic
1025644690 7:63407691-63407713 GAGGGCGAGCAGAAGCAGGTTGG + Intergenic
1027219881 7:76206985-76207007 GAGGGAGTGCTGGACTAGGAGGG - Intronic
1027778309 7:82492999-82493021 GAGGGCGAGCCGAAGCAGGGTGG - Intergenic
1027843270 7:83341461-83341483 GAGGGCGAGCTGAAGCAGTATGG + Intergenic
1028475961 7:91253371-91253393 GAGGATGTGGAGAAATAGGAGGG - Intergenic
1028998447 7:97127095-97127117 GAGGGCGAGCAGAAGCAGCATGG - Intronic
1029101158 7:98131081-98131103 GAGGGCGTGGAGAAAGTGGACGG - Intronic
1029188009 7:98753300-98753322 GAGGCCGTGCACATGTAGGCAGG + Intergenic
1030019612 7:105260395-105260417 GAGGATGTGGAGAAATAGGAAGG + Intronic
1030077193 7:105746901-105746923 GACTGCGGGCAGGAGTAGGAGGG + Intronic
1030166441 7:106560416-106560438 GAGGGCGAGCTGAAGCAGGATGG - Intergenic
1030325944 7:108218228-108218250 GAGGGCGAGCCGAAGCAGGGTGG - Intronic
1030482225 7:110119552-110119574 GAGGGTGAGCAGAAGCAGGCTGG + Intergenic
1030533952 7:110743633-110743655 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1031542873 7:123016388-123016410 GAGGATGTGGAGAAATAGGAAGG - Intergenic
1031612570 7:123844996-123845018 GAGGGCGAGCTGAAGCAGGCGGG - Intronic
1031613852 7:123857477-123857499 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1031717379 7:125125515-125125537 GAGGGCGAGCAGAAGCAGGCTGG - Intergenic
1032312668 7:130802820-130802842 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1032659834 7:133970640-133970662 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1032893225 7:136222315-136222337 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1032957201 7:136984741-136984763 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1033366161 7:140673665-140673687 GAGGGGGTAGAGGAGTAGGAGGG - Exonic
1034314402 7:150116928-150116950 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1034792493 7:153983841-153983863 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1035518134 8:254186-254208 GAGGATGTGGAGAAATAGGAAGG + Intergenic
1035793982 8:2336757-2336779 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1035798823 8:2384951-2384973 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1035984777 8:4415247-4415269 GAGGGGGTGCAGAAGTGAGGCGG - Intronic
1036217987 8:6896798-6896820 GAGGGTTTACAGAGGTAGGAGGG - Intergenic
1036381178 8:8237442-8237464 GGGGGCTTGCAGCAGGAGGAGGG + Intergenic
1036537237 8:9662103-9662125 GAGGATGTGGAGAAATAGGAAGG + Intronic
1037285559 8:17294725-17294747 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1037557679 8:20041289-20041311 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1039133775 8:34297417-34297439 GAGGGCGAGGAGAAGCAGGGTGG + Intergenic
1039281796 8:35994131-35994153 GAGGATGTGGAGAAATAGGAAGG - Intergenic
1040968890 8:53112787-53112809 GAGGGTGAGCTGAAGCAGGATGG - Intergenic
1041287222 8:56273386-56273408 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1041401366 8:57448750-57448772 GAGGGGGAGGAGAAGGAGGAGGG - Intergenic
1041419160 8:57647278-57647300 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1041630658 8:60083230-60083252 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1041716197 8:60934616-60934638 GATGGGGTGCAGATGTAGGTAGG - Intergenic
1041836557 8:62223270-62223292 GAGGGCGAGCCGAAGCAGGGTGG + Intergenic
1041900718 8:62979009-62979031 GAGGGCAAGCAGAAGCAGGGTGG - Exonic
1042622799 8:70724671-70724693 GAGAGCGAGCAGAAGCAGGGTGG - Intronic
1042749072 8:72138432-72138454 GAGGTCCTGCTGGAGTAGGATGG - Intergenic
1042969386 8:74391475-74391497 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1043036749 8:75208635-75208657 GAAGGTGAGCAGAAGCAGGATGG - Intergenic
1043253749 8:78106872-78106894 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1043703535 8:83321616-83321638 GAGGGCGAGTAGAAGCAGGATGG + Intergenic
1044509559 8:93058759-93058781 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1044595354 8:93953565-93953587 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1044940346 8:97335434-97335456 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1045185265 8:99830895-99830917 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1045390499 8:101710120-101710142 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1045973258 8:108103627-108103649 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1045976692 8:108137725-108137747 GAGGGCCTCAAGAAGCAGGAAGG + Intergenic
1046014550 8:108589901-108589923 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1046153560 8:110258200-110258222 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1046776010 8:118164114-118164136 GAGGGAGAGCAGCAGGAGGAAGG + Intergenic
1046947555 8:119988306-119988328 GAGGGCGAGCAGAAGCAGAGTGG - Intronic
1047343915 8:124009209-124009231 GCTGGAGTGCAGAAGGAGGATGG - Intronic
1048084997 8:131167730-131167752 GAGGTCATGCTGAAGTAGGATGG + Intergenic
1050031680 9:1393250-1393272 GAGGGCTAGCAGAAGCAGGGTGG + Intergenic
1050184826 9:2962165-2962187 GGTGGCGTGGAGAAGGAGGACGG - Intergenic
1050234474 9:3563176-3563198 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1050395999 9:5196513-5196535 GAGGAGGTGGAGAAGTAGGGAGG - Intergenic
1050547193 9:6718945-6718967 GAGGTTGTGCAGCAGTAGAAAGG - Intergenic
1050750698 9:8933163-8933185 AAGGGCGAGCAGAAGCAGGGTGG - Intronic
1050963256 9:11765413-11765435 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1051452057 9:17207635-17207657 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1052096678 9:24391776-24391798 GAGGGCGAGCCGAAGCAGGGTGG - Intergenic
1052144127 9:25026158-25026180 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1052146992 9:25061627-25061649 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1052366278 9:27615214-27615236 GAGGGTGAGCAGAAGTAGGGTGG - Intergenic
1052495957 9:29224488-29224510 GAGAGAGGGTAGAAGTAGGAGGG + Intergenic
1052506284 9:29358808-29358830 GAGGGTGAGCAGAAGTAGGGTGG + Intergenic
1052704946 9:31983331-31983353 GGTGGCGTGCATGAGTAGGAGGG + Intergenic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053441621 9:38120958-38120980 GAGGGGGAGGAGAAGGAGGAGGG + Intergenic
1053619416 9:39800334-39800356 GAGGGCCTGCCCAAGTGGGAGGG - Intergenic
1054264740 9:62907109-62907131 GAGGGCCTGCCCAAGTGGGAGGG + Intergenic
1054850654 9:69843464-69843486 GAGGAGGAGGAGAAGTAGGAGGG - Intronic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055061345 9:72072342-72072364 GAGGGCGAGCAGAAGCAGGGTGG + Intronic
1055339053 9:75262234-75262256 GAAGGTGAGCAGAAGCAGGATGG - Intergenic
1055345124 9:75327443-75327465 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1055628676 9:78200799-78200821 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1055642881 9:78334481-78334503 GAGGGCGAGCTGAAGCAGGGCGG + Intergenic
1055823970 9:80301562-80301584 GAGGGCGAGCAGAAGCAGGATGG - Intergenic
1055863611 9:80785824-80785846 GAGGATGTGGAGAAATAGGAAGG + Intergenic
1056385227 9:86091052-86091074 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1056617021 9:88177525-88177547 GAGGGCATGCAGGAGAAGGATGG + Intergenic
1056917536 9:90758253-90758275 GAGGGCCCGGAGAAGGAGGAAGG - Intergenic
1057194294 9:93108202-93108224 GAGGGAGAGCCGAAGTGGGATGG + Intronic
1057483307 9:95462625-95462647 GAGGGGGTGGAGGAGAAGGAAGG + Intronic
1057765280 9:97911290-97911312 GAAGGCTTGCTGAAGTAGGCAGG + Intronic
1058011957 9:99988702-99988724 GAGGGCGAGCCGAAGCAGGGTGG + Intronic
1058069276 9:100585199-100585221 GAGGGAATGAAGAAGGAGGAGGG + Intronic
1058265712 9:102897255-102897277 GAGGGTGAGCAGAAGCAGGGAGG + Intergenic
1058393098 9:104520008-104520030 GAGGGCGAGCCGAAGCAGGGTGG + Intergenic
1058554987 9:106157648-106157670 GAGAGCGAGCAGAACAAGGATGG + Intergenic
1059505919 9:114799841-114799863 GAGGAAGTGCAGAGGCAGGAAGG - Intronic
1059630672 9:116118310-116118332 GAGGATGTGGAGAAATAGGAAGG - Intergenic
1060773454 9:126349373-126349395 GAGGTCTTGCAGAAGCAGGGAGG - Intronic
1061028582 9:128066547-128066569 GGCGGCGTGCATAAGTGGGAAGG - Intronic
1061083467 9:128385877-128385899 GGGGGCGGGCAGAAGAGGGAGGG + Intronic
1061481387 9:130899099-130899121 GAGGGAGGGCAGAGGTAGGGGGG - Intergenic
1062266165 9:135687474-135687496 GATGGCGTGGGGAAGCAGGAAGG + Intergenic
1062612996 9:137383346-137383368 CAGGGCCTGCAGGAGCAGGAGGG + Exonic
1203753947 Un_GL000218v1:106313-106335 GAGAGTGTGGAGAAATAGGAAGG - Intergenic
1203713348 Un_KI270742v1:118847-118869 GAGGATGTGGAGAAATAGGAAGG - Intergenic
1203537858 Un_KI270743v1:59208-59230 GAGGGTGTGGAGAAATAGGAAGG + Intergenic
1185547640 X:958255-958277 GAGGATGTGGAGAAATAGGAAGG - Intergenic
1185911061 X:3981847-3981869 GAGGGCGAGCTGAAGCAGGGTGG + Intergenic
1186332833 X:8554292-8554314 GAGGGCGAGCAGAAGCAGGGTGG + Intronic
1186773393 X:12839656-12839678 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1186832432 X:13404141-13404163 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1186909839 X:14151105-14151127 GAGGCTGTGGAGAAATAGGAAGG - Intergenic
1187248408 X:17574671-17574693 GAGGGTGAGCCGAAGCAGGATGG - Intronic
1187631623 X:21179202-21179224 GAAGGCATGCAGAAATAGGAAGG - Intergenic
1187660759 X:21544734-21544756 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1188130097 X:26420061-26420083 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
1188874631 X:35414799-35414821 GAGTACGTGGAGAAATAGGAAGG - Intergenic
1188915539 X:35905161-35905183 GAGAGTGAGCAGAAGCAGGATGG - Intergenic
1189039848 X:37530754-37530776 GAGGGCGAGTAGAAGCAGGGTGG - Intronic
1189717639 X:43882213-43882235 GAGCGCGTGAAGAGGAAGGAGGG + Intronic
1189754051 X:44252977-44252999 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1189937674 X:46086971-46086993 GAGGGCGAGCCGAAGCAGGGTGG + Intergenic
1189978506 X:46486361-46486383 GAGGGCGAGCTGAAGCAGGGCGG - Intronic
1190056090 X:47181802-47181824 GTGGGAGAGCAGAACTAGGATGG - Exonic
1190505792 X:51125074-51125096 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1190622209 X:52298870-52298892 GAGGGCCAGCTGAAGTAGGGCGG + Intergenic
1190683451 X:52849531-52849553 GAGGGCGAGCTGAAGCAGGGCGG - Intergenic
1190963805 X:55278395-55278417 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1191004996 X:55702268-55702290 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191024202 X:55896238-55896260 GAGGACGAGCAGAAGCAGGGTGG + Intergenic
1191094428 X:56659427-56659449 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1191138820 X:57094483-57094505 GAGGGCGAGCCGAAGCAGGGTGG + Intergenic
1191148181 X:57190691-57190713 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1191174241 X:57482534-57482556 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1191591253 X:62887957-62887979 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191657374 X:63613313-63613335 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1191676556 X:63797624-63797646 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191777043 X:64826024-64826046 GAGGATGTGGAGAAATAGGAAGG + Intergenic
1191788848 X:64946392-64946414 GAGGGCGAGCAGAATCAGGGTGG - Intronic
1191802632 X:65098592-65098614 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1191873016 X:65765674-65765696 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1191987306 X:66995435-66995457 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1192023941 X:67427664-67427686 GAGGTCGTGGAGAAGCAGTATGG - Intergenic
1192524468 X:71829810-71829832 GAGGGCGAGCTGAAGCAGGGTGG + Intergenic
1192703246 X:73498409-73498431 GAGGGTGAGCTGAAGTAGGATGG - Intergenic
1192712695 X:73607784-73607806 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1192759273 X:74078346-74078368 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1192958257 X:76096140-76096162 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1192980292 X:76332183-76332205 GAGGGTGAGCAGAAGCAGGCTGG + Intergenic
1193019981 X:76781082-76781104 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1193043882 X:77032069-77032091 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1193228498 X:79013712-79013734 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1193254102 X:79325977-79325999 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1193361770 X:80587174-80587196 AAGGGCAAGCAGAAGTAGGGTGG - Intergenic
1193394396 X:80967449-80967471 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1193398182 X:81010527-81010549 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1193404398 X:81083781-81083803 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1193476646 X:81974284-81974306 GAGGACATGGAGAAATAGGAAGG + Intergenic
1193514314 X:82445443-82445465 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1193571597 X:83151536-83151558 GAGGACGAGCAGAAGCAGGGTGG + Intergenic
1193645627 X:84065963-84065985 GAGGGTGAGCAGAAGTAGGGTGG + Intronic
1193646698 X:84079160-84079182 GAGGGCGAGCTGAAGGAGGGTGG + Intronic
1193733384 X:85128275-85128297 GAGGATGTGGAGAAATAGGAAGG - Intergenic
1193871121 X:86799533-86799555 GAGGGAGAGCTGAAGCAGGATGG + Intronic
1193897181 X:87128461-87128483 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1194203193 X:90979359-90979381 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1194242484 X:91469628-91469650 GAGGGCGAACAGAAGCAGGTGGG + Intergenic
1194315371 X:92369793-92369815 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1194541816 X:95182456-95182478 GAGGACATTCAGAAGTAGAATGG + Intergenic
1194631539 X:96291548-96291570 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1194643487 X:96429882-96429904 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1194772363 X:97921190-97921212 GAGGGCGAGCCGAAGCAGGGCGG + Intergenic
1194772880 X:97926557-97926579 GAGGATGTGGAGAAATAGGAAGG + Intergenic
1195031134 X:100928798-100928820 GAGCGGGCGCAGAAGAAGGAGGG + Exonic
1195127516 X:101822807-101822829 GAGGGCGAGCGGAAGCAGGGTGG - Intergenic
1195140021 X:101950016-101950038 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1195345041 X:103941006-103941028 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1195434774 X:104829425-104829447 GAGAGCGAGCAGAAGCAGGGTGG - Intronic
1195435996 X:104843688-104843710 GAGAGCAAGCAGAAGCAGGATGG - Intronic
1195451196 X:105014943-105014965 GAGGATGTGGAGAAATAGGAAGG - Intronic
1195508228 X:105684203-105684225 GAGGGCGAGCTGAAGCAGGGCGG + Intronic
1195810708 X:108825504-108825526 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1195820952 X:108944660-108944682 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1195947368 X:110229677-110229699 GAGGGCGAGCTGAAGCAGGGCGG + Intronic
1196133315 X:112181025-112181047 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1196960298 X:120993348-120993370 GAGGGCGAGCTGAAGCACGATGG - Intergenic
1197051097 X:122060879-122060901 GAGGGCCAGCAGAAGCAGGGTGG + Intergenic
1197113578 X:122804830-122804852 GAGGATGTGGAGAAATAGGAAGG + Intergenic
1197184665 X:123573356-123573378 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1197319027 X:125005727-125005749 GAGAGCGAGCAGAAGCAGGATGG + Intergenic
1197395676 X:125923625-125923647 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
1197505917 X:127305663-127305685 GAGGGCGAACAGAAGCAGGGTGG + Intergenic
1197614400 X:128675351-128675373 GAGGGTGAGCAGAAGCAGGGAGG - Intergenic
1198062520 X:133061646-133061668 GAGGGCGAGCAGAAGCAGGGTGG + Intronic
1198293737 X:135263788-135263810 GAGGGCGAGCTGAAGCAGGGCGG - Intronic
1198494493 X:137177769-137177791 GAAGGGGTGCAGAAATGGGAGGG + Intergenic
1198645577 X:138802388-138802410 AAGGGTGAGCAGAAGCAGGATGG - Intronic
1198753460 X:139958778-139958800 GAGGGCGAGCAGAAGCAGAGTGG + Intronic
1198757936 X:140000755-140000777 GAGGGCAAGCAGAAGTAGGGTGG + Intergenic
1198944624 X:141996603-141996625 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1199436528 X:147819213-147819235 GAGGGCGAGCTGAAGCAGGGTGG + Intergenic
1199524976 X:148781980-148782002 GATGGCGAGCAGAAGCAGGATGG - Intronic
1199757044 X:150874472-150874494 GAGGGGCTGCAGGAGTAAGAGGG + Intronic
1200549026 Y:4554785-4554807 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1200623420 Y:5481328-5481350 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1201167594 Y:11223960-11223982 GAGAGTGTGGAGAAATAGGAAGG - Intergenic
1201409082 Y:13680669-13680691 GAGGGTGAGAAGAAGTAGGGTGG + Intergenic
1201498739 Y:14618362-14618384 GAGGGTGAGCAGAAGTAGGATGG - Intronic
1201543145 Y:15131532-15131554 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1201590552 Y:15610496-15610518 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1201609307 Y:15823169-15823191 GAGGGAGTGCAGGAGCAAGATGG + Intergenic
1201920120 Y:19224973-19224995 GAGGATGTGGAGAAATAGGAAGG - Intergenic
1201922123 Y:19245213-19245235 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic