ID: 1091388093

View in Genome Browser
Species Human (GRCh38)
Location 12:107856-107878
Sequence ACTGATATCCATACTCTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 628
Summary {0: 1, 1: 0, 2: 3, 3: 60, 4: 564}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091388093_1091388095 8 Left 1091388093 12:107856-107878 CCTTACAGAGTATGGATATCAGT 0: 1
1: 0
2: 3
3: 60
4: 564
Right 1091388095 12:107887-107909 TGTGAGTTTGCTTATCATTTCGG 0: 1
1: 0
2: 3
3: 25
4: 369
1091388093_1091388097 19 Left 1091388093 12:107856-107878 CCTTACAGAGTATGGATATCAGT 0: 1
1: 0
2: 3
3: 60
4: 564
Right 1091388097 12:107898-107920 TTATCATTTCGGTCCCATCAGGG 0: 1
1: 0
2: 2
3: 3
4: 60
1091388093_1091388096 18 Left 1091388093 12:107856-107878 CCTTACAGAGTATGGATATCAGT 0: 1
1: 0
2: 3
3: 60
4: 564
Right 1091388096 12:107897-107919 CTTATCATTTCGGTCCCATCAGG 0: 1
1: 0
2: 5
3: 14
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091388093 Original CRISPR ACTGATATCCATACTCTGTA AGG (reversed) Intronic
902594439 1:17498970-17498992 ACTAATATCCAGAATCTATAAGG - Intergenic
902903406 1:19536034-19536056 ACAGTTCTCCATACTCCGTAAGG - Intergenic
904637548 1:31895128-31895150 ACAAATATCCAGAATCTGTAAGG + Intergenic
906446252 1:45900879-45900901 ACTAATATCCAGAATCTATAAGG - Intronic
906906705 1:49902295-49902317 TCTGATATCCAGAATCTATAAGG + Intronic
907591492 1:55676511-55676533 TCTAATATCCATAATCTCTAAGG - Intergenic
907952915 1:59201215-59201237 ACTGATATTCATTGTGTGTATGG - Intergenic
909001217 1:70219909-70219931 ACTAATGTAGATACTCTGTAAGG + Intronic
909263961 1:73532692-73532714 TCTCATATCCAGAATCTGTAAGG - Intergenic
909836759 1:80264897-80264919 TCTCATATCCAGAATCTGTAAGG + Intergenic
909989353 1:82203694-82203716 ACTGATATACACAATCTATAAGG - Intergenic
910987316 1:93018141-93018163 ACTAATATCCAAAATCTATAAGG + Intergenic
911036747 1:93558188-93558210 ACTAATATCCAGAATCTATAAGG - Intergenic
911140814 1:94500580-94500602 TCTAATCTCCATACTCTGCAGGG - Intronic
911599456 1:99832632-99832654 ACTAATATCCAGAATCTATAAGG + Intergenic
911652549 1:100406258-100406280 TCTAATATCCAGAGTCTGTAAGG - Intronic
911667785 1:100573569-100573591 TCTAATATCCATCATCTGTAAGG + Intergenic
911963898 1:104341239-104341261 GCTGATATCCAGAATCTATAAGG + Intergenic
912139689 1:106708202-106708224 TCTGATATCCAGACTCTATAGGG - Intergenic
912301718 1:108524626-108524648 ACTGATATCCAGAATCTATAAGG - Intergenic
913044636 1:115063184-115063206 TCTAATATCCAGAATCTGTAAGG + Intronic
913194727 1:116446246-116446268 ACTAATATCCAGAATCTATAAGG - Intergenic
913493934 1:119409850-119409872 ATTCATATCCATCCTCTGAATGG + Intergenic
913507578 1:119532104-119532126 ATTCATATCCATTCTCTGAATGG + Intergenic
913663596 1:121027489-121027511 ACTAATATCCAGACTCTATAAGG + Intergenic
914014994 1:143810771-143810793 ACTAATATCCAGACTCTATAAGG + Intergenic
914162828 1:145150454-145150476 ACTAATATCCAGACTCTATAAGG - Intergenic
914653612 1:149719310-149719332 ACTAATATCCAGACTCTATAAGG + Intergenic
914948792 1:152091388-152091410 ATTAATATCCATACTCTGGGTGG + Intergenic
916005977 1:160660643-160660665 ACTAATATCCAGAATCTGTAAGG - Intergenic
916706892 1:167360048-167360070 ACTAATATCCAAAATCTATAAGG - Intronic
916881138 1:169020310-169020332 ACTGATGTCCATTCTCAGGAGGG + Intergenic
917257366 1:173130154-173130176 ACTAATATCCAGAATCTGCAAGG - Intergenic
918806190 1:189048769-189048791 TCTAATATCCATAATCTATAAGG - Intergenic
920042365 1:203109785-203109807 ACTGATATCCAGAATCTATAAGG + Intronic
922150401 1:222997950-222997972 AATGATAACCATACTCTTTGAGG - Intronic
922888498 1:229040628-229040650 ACTCATATCCAGAATCTGTAAGG + Intergenic
923174571 1:231451852-231451874 ACTAATATCCAGAATCTGCAAGG + Intergenic
924073402 1:240307124-240307146 ACTAATATCCAGAATCTATAAGG - Intronic
924237355 1:242010371-242010393 ACTCATATCCATTATCTATAGGG - Intergenic
924463274 1:244278417-244278439 TCTAATATCCAGAATCTGTAAGG - Intergenic
1063311319 10:4955350-4955372 ACTGATATCCAGAATTTATAAGG - Intronic
1063316476 10:5011119-5011141 ACTGATATCCAAAATTTATAAGG + Intronic
1064569807 10:16680809-16680831 ACAGATATCCAAACTATGTCAGG + Intronic
1064777926 10:18800345-18800367 CCTAATATCCAGAATCTGTAAGG + Intergenic
1065272707 10:24051832-24051854 ACTGATATCCAGAATCTACAAGG - Intronic
1066166558 10:32794800-32794822 TCTAATATCCATAATCTATAAGG - Intronic
1066753120 10:38680443-38680465 ACTAATATCCAGAATCTATAAGG + Intergenic
1066753301 10:38682623-38682645 ACTAATATCCAGAATCTATAAGG + Intergenic
1067034952 10:42907830-42907852 ACTGATAACCAGAATCTGCAAGG + Intergenic
1067672728 10:48339676-48339698 ACTGATATCCATAATAAATAAGG + Intronic
1068310658 10:55270398-55270420 TCTAATATCCAGAATCTGTAAGG + Intronic
1068354005 10:55887009-55887031 ACTAATATCCAGAATCTATAAGG + Intergenic
1069145403 10:64886996-64887018 ACTAATATCCAAAATCTATAAGG - Intergenic
1070234821 10:74612511-74612533 ACTAATATCCAGAATCTATAAGG - Intronic
1071454170 10:85830579-85830601 TCTAATATCCAGAATCTGTAAGG + Intronic
1072018980 10:91379968-91379990 ACAAATATCCAAACTATGTAAGG + Intergenic
1072141167 10:92590457-92590479 ACTCATTACCATGCTCTGTAGGG - Intergenic
1072885807 10:99272537-99272559 ACTGATATCCGGAATCTATAAGG + Intergenic
1072929345 10:99647541-99647563 ACTAATATCCAGAATCTGCAAGG - Intergenic
1073744995 10:106457969-106457991 ACTAATATTCAGAATCTGTAAGG - Intergenic
1073820621 10:107259365-107259387 ACTAATATCCATAATCTACAAGG + Intergenic
1073827711 10:107344464-107344486 ACTGATATCCAGAATGTATAAGG - Intergenic
1074207329 10:111294911-111294933 ACTAATATCCAAAGTCTATAAGG - Intergenic
1074933623 10:118155977-118155999 TCTCATATCCAGACTCTTTAAGG + Intergenic
1075158139 10:119997803-119997825 ACTAATATCCATAATCTACAAGG - Intergenic
1075542067 10:123322877-123322899 ACTAATATCCAGAATCTATAAGG - Intergenic
1076047887 10:127309317-127309339 TCTGATATCCAGAATCTGCAAGG - Intronic
1076211470 10:128649672-128649694 ACTAATATCCAGAATCTGTAAGG + Intergenic
1077759806 11:5081521-5081543 ACTAATATCCAGAATATGTAAGG + Intergenic
1077776101 11:5273118-5273140 ACTGGTGTCCATACTCTGAATGG - Intronic
1077873922 11:6287237-6287259 ACTGTTATCCATACCTTGTATGG - Intergenic
1078029294 11:7733094-7733116 GCTAATATCCAGAATCTGTAAGG + Intergenic
1078039173 11:7842158-7842180 ACTAATATCCAGAGTCTATAAGG - Intergenic
1078514800 11:12012702-12012724 ACTAATATCCAGAATCTATAAGG + Intergenic
1079463776 11:20708603-20708625 ACTAATATCCAGACTCTACAAGG - Intronic
1079709559 11:23665013-23665035 TCTAATATCCAGAATCTGTAAGG - Intergenic
1079713308 11:23713295-23713317 TCTAATATCCATAATCTATAAGG - Intergenic
1079764245 11:24370745-24370767 TCTGATATCCAGAATCTATAAGG - Intergenic
1079982858 11:27169734-27169756 TCTAATATCCACAATCTGTAAGG - Intergenic
1080130136 11:28784444-28784466 ACTAATATCCACAATCTATAAGG - Intergenic
1080709080 11:34728885-34728907 CCTAATATCCATGATCTGTAAGG - Intergenic
1080953007 11:37058058-37058080 ACTAATATCCAGAATCTATAAGG + Intergenic
1081167582 11:39824840-39824862 ACTAATATCCAGAATCTATAAGG + Intergenic
1081342103 11:41941321-41941343 TCTAATATTCAGACTCTGTAAGG + Intergenic
1081471366 11:43374528-43374550 TCTGATATCCAGAATCTATAAGG + Intronic
1081696468 11:45112830-45112852 ACTCATATCCAGAATCTGCAAGG - Intronic
1081822713 11:46015223-46015245 ATTAATATCCAGAATCTGTAAGG - Intronic
1082114455 11:48313219-48313241 TCTAATATCCAAAGTCTGTAAGG + Intergenic
1083537656 11:63485887-63485909 ACTAATATCCAAAATCTGCAAGG + Intronic
1085138400 11:74116236-74116258 ACTAATATCCAGAATCTATAAGG + Intronic
1086548340 11:88025751-88025773 TCTAATATCCAGACTCTATAAGG - Intergenic
1086824556 11:91479926-91479948 TCTAATATCCAGAATCTGTAAGG + Intergenic
1087912136 11:103766509-103766531 TCTGATATCCAGAATCTGTAAGG - Intergenic
1087931533 11:103983681-103983703 TCTAATATCCAGACTCTATAAGG + Intronic
1088387047 11:109270534-109270556 ACTAATATCCAGAATCTATAAGG - Intergenic
1090683084 11:129082836-129082858 ACTGATATCCAGAATCTACAAGG + Intronic
1090685594 11:129114912-129114934 ACTGATTTCCATTCTCCATATGG - Intronic
1090729986 11:129562949-129562971 TCTAATATCCAGACTCTATAAGG + Intergenic
1090895231 11:130966115-130966137 TCTAATATCCAGACTCTATAAGG - Intergenic
1091126121 11:133099796-133099818 GCTGATATCCAGAATCTATAAGG - Intronic
1091244106 11:134077327-134077349 ACTAATATCCAGAATCTATAAGG - Intronic
1091336400 11:134771144-134771166 ACTAATATCCAGAATCTATAAGG + Intergenic
1091388093 12:107856-107878 ACTGATATCCATACTCTGTAAGG - Intronic
1091811511 12:3402583-3402605 TCTAATATCCATAGTCTATAAGG + Intronic
1092441169 12:8505892-8505914 TCTAATATCCAGAATCTGTAAGG - Intergenic
1092482992 12:8877448-8877470 ACTAATATCCAGAATCTATAAGG + Intronic
1093456761 12:19372433-19372455 ACTAATATCCAGAATCTGGAAGG - Intronic
1093770895 12:23017296-23017318 ACTGATATCCAGAATCTACAAGG - Intergenic
1094290280 12:28840633-28840655 ACTAATATCCAGCATCTGTAAGG + Intergenic
1095259015 12:40077032-40077054 TCTAATATCCAGATTCTGTAAGG - Intronic
1095846044 12:46746145-46746167 TCTAATATCCAGAATCTGTAAGG + Intergenic
1096036907 12:48480339-48480361 ACTAATATCCAGAATCTATAAGG - Intergenic
1096042901 12:48534988-48535010 TCTAATATCCAGACTCTATAAGG + Intergenic
1097822476 12:64142181-64142203 AAAGATATCCATACTCTGCTGGG + Intronic
1098058006 12:66528904-66528926 ACTAATATCCAGAATCTGTAGGG + Intronic
1098224348 12:68306509-68306531 ACTAATATCCAGAATCTATAAGG + Intronic
1098303001 12:69073473-69073495 ACTAATATCCAGAATCTGCAAGG + Intergenic
1098399689 12:70061183-70061205 TCTAATATCCAGAATCTGTAAGG + Intergenic
1098518992 12:71414116-71414138 ACTAATATCCAGAATCTATAAGG + Intronic
1098694090 12:73529213-73529235 ACTAATATCCAGAATCTATAAGG - Intergenic
1098700754 12:73622493-73622515 TCTGATATCCAGAATCTGCAAGG - Intergenic
1099060399 12:77901102-77901124 CCTAATATCCAGAATCTGTAAGG - Intronic
1099242964 12:80160352-80160374 ACTAATATCCAGAATCTGCAAGG + Intergenic
1099293614 12:80803015-80803037 ACTAATATCCAAAATATGTATGG - Intronic
1099398101 12:82167072-82167094 ACTAATATCCAGAATCTATAAGG + Intergenic
1099764435 12:86964372-86964394 ACTAATATCCAAAATCTATAAGG - Intergenic
1099821449 12:87716381-87716403 TCTGATATCCATAGTCTATAAGG + Intergenic
1099835543 12:87906742-87906764 TCTAATATCCATAATCTATAAGG + Intergenic
1099860616 12:88221389-88221411 TCTAATATCCAGAATCTGTAAGG + Intergenic
1100704770 12:97188252-97188274 ACTCATATCCAAAAGCTGTAAGG + Intergenic
1100730369 12:97460621-97460643 ACACATATCCACACTCTTTATGG + Intergenic
1100869757 12:98897340-98897362 ACTAATATCCATAATCGATAAGG + Intronic
1101187674 12:102296557-102296579 ACTAATATCCAGAATCTATAAGG - Intergenic
1101295101 12:103414364-103414386 ACTGGTATCCAGAATCTGCAAGG - Intronic
1102104337 12:110307725-110307747 ACTAATATCCAGAATCTATAAGG - Intronic
1102847481 12:116202251-116202273 TCTGAAATCCATATTCAGTAAGG + Intronic
1105002557 12:132700556-132700578 ACTGTTATCCAGAATCTGTGAGG - Intronic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1105989969 13:25609993-25610015 ACTAATATCCAGAATCTGCAAGG - Intronic
1107201419 13:37723289-37723311 ATTGATATTCATACTCTATAAGG + Intronic
1107311060 13:39078654-39078676 ACTAATACCCAGAATCTGTAAGG + Intergenic
1107319734 13:39173166-39173188 ATTGATATCCATACTATACAAGG - Intergenic
1108609905 13:52074743-52074765 TCTAATATCCAGACTCTATAAGG + Intronic
1109000455 13:56795845-56795867 TCTAATATCCATAATCTATAAGG + Intergenic
1109033354 13:57222729-57222751 ACTAATATCCAGAATCTGCAAGG + Intergenic
1109255006 13:60069355-60069377 TCTGATATCCAGAATCTATAAGG - Intronic
1109383953 13:61603070-61603092 ACTAATATCCAGAATCTATAAGG - Intergenic
1109420139 13:62100874-62100896 ACTAATATCCATAATCTACAAGG - Intergenic
1109652366 13:65346017-65346039 ACTAATATCCAGAATCTGTAAGG + Intergenic
1109905848 13:68840234-68840256 ACTAATATCCAGACTCTACAAGG - Intergenic
1110064435 13:71086188-71086210 TCTGATATCCAGCCTCTATAAGG - Intergenic
1110245187 13:73315512-73315534 ATTGATATCCAGAATATGTAAGG + Intergenic
1110336654 13:74340119-74340141 ACTAATATCCAGAATCTATAAGG - Intergenic
1110338142 13:74356714-74356736 TCTGATATCCAGAATCTATAAGG - Intergenic
1110461793 13:75753287-75753309 ACTGATATCCAGAATTTATAAGG - Intronic
1110688234 13:78400647-78400669 ACTGAAATCCATTTTCTTTATGG + Intergenic
1110876384 13:80516020-80516042 TCTAATATCCAGAATCTGTAAGG - Intergenic
1111226023 13:85272026-85272048 ACTAATATCCAGAGTCTGTAAGG + Intergenic
1111271650 13:85894407-85894429 ATTGTTATCTATACTCTTTAAGG - Intergenic
1112863964 13:103870971-103870993 ACTCATATCCAGAATCTATAAGG - Intergenic
1112879295 13:104086083-104086105 ACTAATATCCATAATCTACAAGG + Intergenic
1114888430 14:26885230-26885252 ATTGATATCCATAATATATAAGG - Intergenic
1114951900 14:27765137-27765159 TCTAATATCCAGAATCTGTAAGG + Intergenic
1115061755 14:29200200-29200222 TCTGATATCCAGAATCTATAAGG + Intergenic
1115947640 14:38680386-38680408 ACTAATATCCAGAATCTGCAAGG - Intergenic
1116038042 14:39652699-39652721 GCTGATATCCAAAATATGTAAGG + Intergenic
1116286284 14:42976336-42976358 ACTAATATTCATAATCTATAAGG - Intergenic
1116361722 14:44006757-44006779 ACTAATATCCAGAATCTATAGGG - Intergenic
1116395290 14:44441255-44441277 ACTAATACCCATAATCTATAAGG + Intergenic
1117105945 14:52397163-52397185 ACTAATATCCAGAATCTATAAGG - Intergenic
1117360798 14:54971789-54971811 TCTGATATCCAGAGTCTATAAGG + Intronic
1117917905 14:60697497-60697519 ACTAATATCCAGAATCTATAAGG - Intergenic
1118644857 14:67828374-67828396 TCTAATATCCAGACTCTATAAGG - Intronic
1118965385 14:70578604-70578626 ACTAATATCCAGAATCTATAAGG + Intergenic
1119489807 14:75021439-75021461 ACTAATATCCAGAATCTATAAGG + Intronic
1119607129 14:76029340-76029362 ACTAATATCCAAAATCTATAAGG - Intronic
1120367173 14:83585853-83585875 TCTAATATCCAGACTCTGTAAGG + Intergenic
1120373466 14:83668932-83668954 ACTAATATCCAGAATCTATAAGG + Intergenic
1120556574 14:85935187-85935209 CCTAATATCCAGAATCTGTAAGG - Intergenic
1120575059 14:86171697-86171719 ACTAATATCCATAGTCTACAAGG + Intergenic
1121686250 14:95837436-95837458 ATTGAAATCCATACTTTGCAGGG + Intergenic
1123140768 14:106075562-106075584 ACTAATATCCAGAATCTATAGGG - Intergenic
1124473909 15:30014319-30014341 TCTAATATCCAGATTCTGTAGGG - Intergenic
1124682875 15:31751181-31751203 ACTAATATCCATAATCTATAAGG + Intronic
1124850582 15:33334790-33334812 TCTAATATCCAGCCTCTGTAAGG + Intronic
1124858730 15:33416566-33416588 ACTAATATCCAGAATCTATAAGG - Intronic
1125282290 15:38055661-38055683 ACAGAATTCCATACTTTGTAGGG - Intergenic
1125331961 15:38591376-38591398 ACTGATCTCCTTCCTCTGTGTGG - Intergenic
1125823559 15:42655840-42655862 ACTAATATCCAGACTCTACAAGG + Intronic
1125892644 15:43277704-43277726 ACTGATATCCATCATCTGGCCGG - Intronic
1126286284 15:47015392-47015414 ACTGATATCCAAAATCTACAGGG - Intergenic
1126500688 15:49340642-49340664 TCTTATATCCAGAATCTGTAAGG - Intronic
1126642885 15:50845478-50845500 ACTGATATCCAGAATCTACAAGG + Intergenic
1126669747 15:51105125-51105147 ACTGGTTTCCACACTCTGTGAGG - Exonic
1126718509 15:51549839-51549861 ACTAATATCCAGAATCTATAAGG - Intronic
1126997025 15:54455748-54455770 ACTAATATCCAGAATCTATAAGG - Intronic
1127003464 15:54538090-54538112 TCTAATATCCAGACTCTATAAGG + Intronic
1127055029 15:55122642-55122664 CCTAATATCAAGACTCTGTAAGG + Intergenic
1127163736 15:56220562-56220584 TCTAATATCCAGAGTCTGTAAGG - Intronic
1131853971 15:96572485-96572507 ACTAATATCCAGAATCTATAAGG - Intergenic
1132412477 15:101593410-101593432 ACTAATATCCAGAATCTATAAGG - Intergenic
1136715187 16:32274644-32274666 CCTAATATCCAGACTCTATAGGG + Intergenic
1136729406 16:32394392-32394414 ACTAATATCCAAAATCTATAAGG - Intergenic
1136729576 16:32396568-32396590 ACTAATATCCAGAATCTATAAGG - Intergenic
1136752728 16:32655087-32655109 CCTAATATCCAGACTCTATAGGG - Intergenic
1138792770 16:59927161-59927183 CCTAATATCCAAAATCTGTAAGG - Intergenic
1140143988 16:72287556-72287578 ACTGAAATCTATAATCTATAAGG - Intergenic
1202996820 16_KI270728v1_random:120725-120747 ACTAATATCCAGAATCTATAAGG + Intergenic
1202996987 16_KI270728v1_random:122901-122923 ACTAATATCCAAAATCTATAAGG + Intergenic
1203023507 16_KI270728v1_random:433067-433089 ACTAATATCCAGAATCTATAAGG + Intergenic
1203023674 16_KI270728v1_random:435243-435265 ACTAATATCCAAAATCTATAAGG + Intergenic
1203054865 16_KI270728v1_random:915125-915147 CCTAATATCCAGACTCTATAGGG - Intergenic
1142939257 17:3368113-3368135 ACTAATATCCAGAATCTATAAGG - Intergenic
1144243041 17:13332941-13332963 ACTAATATCCAGAATCTATAAGG - Intergenic
1146754454 17:35415622-35415644 ACTGATATCCAGAATCTATGAGG + Intronic
1146829226 17:36053455-36053477 ACTAATATCCATAATCTATAAGG + Intergenic
1147529148 17:41257740-41257762 TCTAATATCCAGAATCTGTAAGG - Intergenic
1148040755 17:44704945-44704967 ACTAATATCCAGAATCTATAAGG - Intergenic
1149398280 17:56267308-56267330 TCTGATATCCATAATCTATAAGG - Intronic
1150459870 17:65341116-65341138 TCTAATATCCAGACTCTATAAGG + Intergenic
1150948340 17:69773061-69773083 TCTGATATTCAAAATCTGTAAGG + Intergenic
1151060781 17:71091300-71091322 TCTAATATCCAGAATCTGTAAGG - Intergenic
1151065611 17:71146253-71146275 ATGGATATCCAAACTCTGAATGG + Intergenic
1153108416 18:1555589-1555611 ACTAATATCCAGAATCTATAAGG - Intergenic
1153175892 18:2372644-2372666 ACTTATATCCAGAATCTATAAGG - Intergenic
1153573756 18:6499843-6499865 ACTGATATCCAGAATCTACAAGG - Intergenic
1155190962 18:23429886-23429908 ACTAATATCCACAATCTATAAGG - Intronic
1155757175 18:29513822-29513844 TCTAATATCCATAATCTGTAAGG - Intergenic
1155758353 18:29530953-29530975 AATGATATCGATAATCTGTTGGG + Intergenic
1155758455 18:29532723-29532745 TCTAATATCCACAATCTGTAGGG + Intergenic
1155776998 18:29777266-29777288 ACTGATATCCAGAATCTATAAGG - Intergenic
1156096351 18:33537277-33537299 ACTAATATCTAGAATCTGTAAGG + Intergenic
1156288973 18:35728631-35728653 CCTGATATCCAGAATCTATAAGG + Intergenic
1156426068 18:37014218-37014240 TCTAATATCCATAATTTGTAAGG - Intronic
1157400846 18:47385428-47385450 CCTAATATCCAGAATCTGTAAGG - Intergenic
1158738884 18:60116310-60116332 ACTAATATCCAGACTCTAGAAGG + Intergenic
1158799148 18:60885628-60885650 TCTAATATCCAAACTCTATAAGG + Intergenic
1159515859 18:69457026-69457048 TCTAATATCCAGAATCTGTAAGG - Intronic
1159776782 18:72611621-72611643 TCTAATATCCATAATCTATAAGG - Intronic
1160219846 18:76966729-76966751 CCCAATATCCATACTCTGAAGGG - Intronic
1162492483 19:11001700-11001722 ACTGATATCCCTCCGCTGTGTGG + Intronic
1164431788 19:28195123-28195145 ACTAATATCTAGAATCTGTAAGG - Intergenic
1164996682 19:32725088-32725110 TCTAATATCCAGAATCTGTAAGG - Intronic
925110710 2:1334054-1334076 ACTAATATCCAGACTCTGCAAGG + Intronic
927027722 2:19086946-19086968 ACAAATATCAATACTCTGTTAGG + Intergenic
927183285 2:20463883-20463905 GCTAATATCCAGAATCTGTAAGG + Intergenic
928147798 2:28795676-28795698 TCTAATATCCAGACTCTATAAGG - Intronic
928188473 2:29137888-29137910 ACTAATATCCAGAATCTATAAGG - Intronic
928525755 2:32138562-32138584 TCTGATATCCAGAATCTATAAGG - Intronic
928581754 2:32714958-32714980 TCTGATATCCATAATCTATAAGG - Intronic
928955523 2:36863052-36863074 ACCAATATCCAGAATCTGTAAGG - Intronic
929454384 2:42055621-42055643 ACTGATACCCCTACTCTGGATGG + Intronic
929707083 2:44225117-44225139 ACTGGAATCCTTACTTTGTAGGG + Intronic
929930031 2:46247187-46247209 TCTAATATCCATAATATGTAAGG - Intergenic
930149278 2:48041939-48041961 TCTGATATCCAGAGTCTGCAAGG - Intergenic
930281964 2:49379842-49379864 ACTGCCATACATTCTCTGTAGGG - Intergenic
930489280 2:52047701-52047723 CCTAATATCCATTCTCTGTCAGG + Intergenic
931519937 2:63084606-63084628 ACTAATATCCAGAGTCTATAAGG - Intergenic
931919491 2:66997749-66997771 ACTGATATCCAGAATCTATAAGG - Intergenic
932270848 2:70408089-70408111 ACTAATATCCAGACTCTACAAGG + Intergenic
932535275 2:72586350-72586372 TCTGATATCCAGAATCTATAAGG + Intronic
932647242 2:73516059-73516081 TCTAATATCCAGAATCTGTAAGG + Intronic
933340594 2:81020821-81020843 ACTAATATCCAGAATCTGCAAGG - Intergenic
933398316 2:81760035-81760057 ACTAATATCCACAATCTGCAAGG + Intergenic
933523302 2:83403131-83403153 ACTAATATCCAGAATCTATAAGG + Intergenic
934185706 2:89672429-89672451 ACTAATATCCAGAATCTATAAGG - Intergenic
934185880 2:89674609-89674631 ACTAATATCCAGAATCTATAAGG - Intergenic
935830542 2:106997041-106997063 TCTGATGTCCATAGTCTATAGGG + Intergenic
936857177 2:116972779-116972801 TCTAATATCCAGAATCTGTAAGG - Intergenic
937138832 2:119580295-119580317 ACTGAAGACCATACACTGTACGG + Intronic
937498983 2:122457179-122457201 ACTAATATCCAGAATTTGTAAGG + Intergenic
937508674 2:122568273-122568295 ACTAATATCCAGAATCTATAAGG + Intergenic
937724990 2:125152995-125153017 TCTAATATCCATAATCTATAAGG - Intergenic
938147030 2:128843475-128843497 ACTGATATCCAGAATTTATAAGG - Intergenic
938191513 2:129285951-129285973 ACTAATATCTAGACTGTGTAAGG - Intergenic
938209128 2:129450950-129450972 CCTGATATCCAGAATCTATAAGG + Intergenic
938865118 2:135410728-135410750 ACTAATATCTAGACTCTATAAGG + Intronic
939364791 2:141217843-141217865 ACTGATGTCCAAAATCTTTAAGG + Intronic
939440634 2:142245019-142245041 AATGATAATCATATTCTGTAAGG - Intergenic
940806145 2:158188852-158188874 ACTAATATCCAGAATCTATAAGG + Intronic
941551228 2:166917925-166917947 ACTGATTTTCATACTCTATCAGG + Intronic
942119457 2:172762404-172762426 ACTGAGATCTATGCTCTTTATGG + Intronic
942775245 2:179573683-179573705 ATAGAAATCAATACTCTGTAAGG + Intronic
943057407 2:182999258-182999280 ACTAATATCCAGAATCTATACGG + Intronic
943153435 2:184143885-184143907 TCTAATATCCAGAATCTGTAAGG + Intergenic
943205105 2:184884959-184884981 TCTAATATCCAGAATCTGTAAGG + Intronic
943286057 2:186001867-186001889 ACTGTTATCTATACTCTTGAGGG + Intergenic
943391153 2:187269770-187269792 ACTAATATCCAGAATCTATAAGG - Intergenic
943714892 2:191140357-191140379 ACTAATATCCATAATCTGCAAGG + Intronic
944370612 2:198978620-198978642 ACTAATATCCAGAATCTATAAGG + Intergenic
944773616 2:202938957-202938979 TCTAATTTCAATACTCTGTAGGG + Intronic
944849345 2:203701925-203701947 TCTAATATCCAGAATCTGTAAGG + Intergenic
945286158 2:208084391-208084413 ACTAATATCCAGAATCTATAAGG + Intergenic
945722433 2:213434581-213434603 ACTGATATCCAGAATTTATAGGG + Intronic
946765239 2:223034631-223034653 TCTAATATCCAGAATCTGTAAGG - Intergenic
946944772 2:224809456-224809478 GCTGATATCCAAACTCTACAAGG + Intronic
947203459 2:227637826-227637848 TCTGATATCCATAATCTATAAGG + Intergenic
1168938895 20:1692015-1692037 GCTGATATCCAGAATCTATAAGG + Intergenic
1169549599 20:6688625-6688647 ACTGAAATCCATTCCTTGTAAGG - Intergenic
1169855521 20:10097954-10097976 ACTAATATCCATAATCTACAAGG - Intergenic
1170070898 20:12365836-12365858 ACTAATATCCAGAATCTATAAGG + Intergenic
1173281211 20:41629729-41629751 TCTAATATCCAGAATCTGTAAGG - Intergenic
1177548726 21:22593765-22593787 ACTAATATCCAGAATCTATAAGG + Intergenic
1177574393 21:22932288-22932310 ACTAATATCCAGAGTCTATATGG - Intergenic
1178017940 21:28373240-28373262 ACTAGTATCCAGAATCTGTAAGG - Intergenic
1179400996 21:41083308-41083330 ACTAATATCCAGAATCTATAAGG - Intergenic
1179946339 21:44680148-44680170 ACTAATATCCAGAATATGTAAGG + Intronic
1180394260 22:12315140-12315162 GCTAATATCCAGAATCTGTAAGG - Intergenic
1180405485 22:12549609-12549631 GCTAATATCCAGAATCTGTAAGG + Intergenic
1180542893 22:16468482-16468504 ACTAATATCCAGAATCTATAAGG + Intergenic
1180543070 22:16470668-16470690 ACTAATATCCAGAATCTATAAGG + Intergenic
1181717508 22:24743002-24743024 ACTGATATCCAGAATCTACAAGG + Intronic
1182970778 22:34574236-34574258 ACTAATATCCAGAATCTATAAGG + Intergenic
949520595 3:4849963-4849985 ACTGATATCCCCACTCTGGAAGG - Intronic
949652977 3:6182367-6182389 TCTAATATCCAGAATCTGTAAGG + Intergenic
950917543 3:16661336-16661358 ACTAATATCCAGACTCTATAAGG + Intronic
951268079 3:20593130-20593152 ACTAATATCCAGAATCTATAAGG - Intergenic
951284936 3:20799040-20799062 TCTGATATCCAGAATCTATAAGG - Intergenic
951514540 3:23544319-23544341 ACTGATATCCAGAATCTACAAGG + Intronic
953079692 3:39604475-39604497 TCTAATATCCAGACTCTTTATGG - Intergenic
953155716 3:40370995-40371017 TCTAATATCCAGAATCTGTAAGG + Intergenic
954483193 3:50821024-50821046 ACTAATATCCAGAATCTATAAGG - Intronic
954527672 3:51287078-51287100 TCTGATAACCAGAATCTGTAAGG + Intronic
955257935 3:57353640-57353662 TCTAATATCCAAAATCTGTAAGG + Intronic
957349869 3:79009850-79009872 ACTGTTATCCAACTTCTGTAAGG - Intronic
957688464 3:83536371-83536393 ACTGATATCCAGAATTTGCAAGG + Intergenic
957973686 3:87416302-87416324 ACTAATATCTATAATCTATATGG + Intergenic
958484424 3:94685604-94685626 ACTGGTATCCAGACTCTACAAGG + Intergenic
958607968 3:96384585-96384607 ACTGATATCCAGAATTTATAAGG - Intergenic
959047196 3:101487350-101487372 TCTAATATCCAGATTCTGTAAGG - Intronic
959181310 3:102984102-102984124 TCTAATATCCAGAATCTGTAAGG + Intergenic
959213051 3:103413572-103413594 TCTAATATCCAGAATCTGTAAGG - Intergenic
959324013 3:104912919-104912941 TCTAATATCCAGAATCTGTAAGG + Intergenic
960480565 3:118183200-118183222 CCTAATATCCAGACTCTATAAGG - Intergenic
960549108 3:118953780-118953802 ACTAATATCCAGAATCTGCAAGG - Intronic
960578516 3:119251904-119251926 ACTAATATCCAGAATCTATAAGG + Intergenic
960617641 3:119610690-119610712 ACTAATATCCAGAATCTATAAGG - Intronic
961227774 3:125268958-125268980 ACTAATATCCAGAACCTGTAAGG + Intronic
961265509 3:125638758-125638780 ACTAATATCCAGAATCTATAAGG + Intergenic
961350481 3:126298332-126298354 ACTAATATCCAGAATCTGCAAGG - Intergenic
961407897 3:126695341-126695363 ACTGATATCCAGAATCTGTAAGG - Intergenic
962144563 3:132826580-132826602 ACTAATATCCAGACTCTACAGGG - Intergenic
963383979 3:144567783-144567805 ACTAATATCCAGAATCTGCAAGG + Intergenic
963832350 3:150021903-150021925 TCTAATATCCAGAATCTGTAAGG + Intronic
964828389 3:160855485-160855507 GCTAATATCCGTAATCTGTAAGG + Intronic
965167154 3:165209636-165209658 ACTGATATCTATACTTTTTATGG + Intergenic
965254708 3:166391038-166391060 ACTGGTATCCAGAATCTATAGGG - Intergenic
965410375 3:168322799-168322821 ACTGATATCATTTCTCTGAAAGG + Intergenic
965639419 3:170816866-170816888 ACTGAAATCCAAACACTGAAGGG - Intronic
966093174 3:176164970-176164992 ACTGATATACAGAATCTATAAGG + Intergenic
966323227 3:178724382-178724404 ACTGATATCCAGATTCTATAAGG - Intronic
966369390 3:179231990-179232012 ACTAATATCCAGAATCTATAAGG - Intronic
966969926 3:185034515-185034537 CCTAATATCCAGACTCTATAGGG - Intronic
967122401 3:186394474-186394496 TCTAATATCCAGAATCTGTAAGG + Intergenic
968019300 3:195370130-195370152 TCTAATATCCAGAATCTGTAAGG - Intronic
970184632 4:13437475-13437497 ACTAATATCCAGAATCTGTAAGG + Intronic
970268786 4:14320319-14320341 ACTAATATCCAGACTCTACAAGG + Intergenic
971169651 4:24219988-24220010 ACTAATATCCATAATCTATAAGG + Intergenic
971276326 4:25201018-25201040 ACTAATATCCAGAATCTATAAGG + Intronic
972018377 4:34275604-34275626 ACTGATATTCAGAATCTATAAGG - Intergenic
972061352 4:34877547-34877569 TCTGATATCCAGAATCTATAAGG + Intergenic
972214934 4:36886506-36886528 TCTGATATCCAGAATCTGTAAGG - Intergenic
972419614 4:38874545-38874567 TCTAATATCCAGAATCTGTAAGG - Intronic
972860832 4:43167824-43167846 ACTGATATCCAGAATCTACAAGG - Intergenic
973012281 4:45092037-45092059 TCTAATATCCAGAATCTGTAAGG + Intergenic
973835473 4:54805162-54805184 ACTAATATCCAGAGTCTTTAAGG + Intergenic
974081977 4:57223486-57223508 ACTGATATCCAAAATCTACAAGG - Intergenic
974366312 4:60954250-60954272 TCTAATATCCAGAGTCTGTAAGG - Intergenic
974376180 4:61079490-61079512 ACTAATATCCAGAATCTGCAAGG + Intergenic
974801434 4:66823914-66823936 ACTAATATCCAGAATCTATAAGG - Intergenic
975746240 4:77478039-77478061 ACTAATATCTAGAATCTGTAAGG + Intergenic
975967437 4:79991213-79991235 TCTAATATCCAGAATCTGTAAGG + Intronic
976666291 4:87596328-87596350 ACTAATATCCAGAATCTGCAAGG - Intergenic
977655285 4:99514366-99514388 ACTAATATCCAGAATCTATAAGG + Intronic
977812887 4:101378650-101378672 TCTGATATCCAGAATCTCTAAGG - Intergenic
977948393 4:102940741-102940763 ACTAATATCCAGAATCTATAAGG + Intronic
977948577 4:102942939-102942961 ACTAATATCCAGAATCTATAAGG + Intronic
978127877 4:105156377-105156399 AAAAATATCAATACTCTGTATGG - Intronic
978315864 4:107436420-107436442 ACTAATATCCAGAATCTATAAGG + Intergenic
979426738 4:120576687-120576709 ACTGATATCCAAAATCTCCAAGG + Intergenic
979692211 4:123572114-123572136 TCTGCTATCCAGAATCTGTAAGG + Intergenic
979795190 4:124837742-124837764 ACTGATACGCAGACTATGTAAGG - Intergenic
980586447 4:134822654-134822676 ACTAATATCCAGAATCTGCAAGG - Intergenic
980994582 4:139768128-139768150 ACTAATATCCAAAATCTATAAGG - Intronic
981168909 4:141598265-141598287 ACTAATATCCATAATCTACAAGG + Intergenic
981926308 4:150143920-150143942 ACTAATATCCAGAATCTATAAGG - Intronic
982636332 4:157901419-157901441 ACTGATATCCAGAATCTATAAGG - Intergenic
982850710 4:160311946-160311968 GCTAATATCCATAGTCTGTAAGG - Intergenic
983018792 4:162648466-162648488 ACTAATATCCAGAATCTATAAGG - Intergenic
983122052 4:163898302-163898324 ACTAATATCCAAAATCTGCAAGG + Intronic
983174680 4:164574489-164574511 ACTAATATCCAAAATCTATAAGG + Intergenic
983404701 4:167313243-167313265 ACTGATATCCAGAATCTACAAGG + Intergenic
983749505 4:171248242-171248264 ACTAATATCCATAATCTATAAGG - Intergenic
983755766 4:171333389-171333411 TCTGATATCCAGAAACTGTAAGG + Intergenic
984203467 4:176756645-176756667 ACTAAAATCCAAACTCTGTATGG - Intronic
984428055 4:179613350-179613372 ACTAATATCCAGAATCTGCAAGG + Intergenic
984482489 4:180323714-180323736 TCTAATATCCAGAGTCTGTAAGG - Intergenic
985332152 4:188849780-188849802 ACTAATATCCAAAATATGTAAGG - Intergenic
986136112 5:4979904-4979926 TCTGATATCCAGAATCTATAAGG - Intergenic
986893212 5:12334140-12334162 ACTGATATCCAGAATCTTCAAGG - Intergenic
986909668 5:12539407-12539429 ACTAATATCCAGAGTCTATAAGG + Intergenic
986917760 5:12644101-12644123 ACTAATATCCAGATTCTGCAAGG + Intergenic
987250245 5:16093260-16093282 ACTGATATCTATTTTCTGTTTGG + Intronic
987468556 5:18302197-18302219 TCTAATATCCATAATCTATAAGG - Intergenic
987806309 5:22773755-22773777 TCTGATATCCAGAATCTATAAGG + Intronic
987842636 5:23240309-23240331 ACAGACATCCACACTCTGTTTGG + Intergenic
988072850 5:26316580-26316602 ACTGATATCCAGAATCTATAAGG - Intergenic
988134689 5:27155742-27155764 ACTAATATCCAGACTCTTCAAGG - Intergenic
988177801 5:27749558-27749580 ACTAATATTCATAATCTATAAGG + Intergenic
988325721 5:29764591-29764613 ACTGATATCCAGAATCTATAAGG - Intergenic
988390540 5:30622767-30622789 GCTAATATCCAGAATCTGTAAGG + Intergenic
988587364 5:32519162-32519184 TCTGATATCCAGAATCTATAAGG + Intergenic
988740583 5:34065153-34065175 ACTAATATCTAGAATCTGTAAGG + Intronic
989347737 5:40448807-40448829 ACTAATATCCAGAATCTGCAAGG - Intergenic
989468209 5:41782625-41782647 ACTAATATCCAGAGTCTGGAAGG - Intronic
989696781 5:44211202-44211224 GCTAATATCCAGAATCTGTAAGG - Intergenic
990134159 5:52625011-52625033 TCTAATATCCAGAATCTGTAAGG - Intergenic
990486778 5:56267083-56267105 TCTAATATCCAGACTCTATAAGG - Intergenic
991027572 5:62046927-62046949 TCTGATATCCACAATCTATAAGG - Intergenic
993230388 5:85227783-85227805 ACTCATATCCAGAATCTATAAGG - Intergenic
993234008 5:85279549-85279571 TCTAATATCCATAATCTATAAGG + Intergenic
993284484 5:85973892-85973914 ACAGATTTCCATACTTTTTATGG - Intergenic
993433404 5:87860728-87860750 ACTAATATCCAGAATCTATAAGG - Intergenic
993525360 5:88959003-88959025 CTTGATATATATACTCTGTAGGG + Intergenic
994021771 5:95034832-95034854 ACTAATATCCAGAATCTATAAGG + Intronic
994897005 5:105719558-105719580 ACTTATATCCAGAATCTATAAGG + Intergenic
994944095 5:106362655-106362677 CCTAATATCCAGAATCTGTAAGG - Intergenic
995155776 5:108911347-108911369 ACTAATATCCAGAATCTATAGGG - Intronic
995318021 5:110798041-110798063 TCTAATATCCAGAATCTGTAAGG - Intergenic
995626401 5:114081877-114081899 ATTGATATCTAGACTATGTAGGG + Intergenic
995778670 5:115752943-115752965 TCTAATATCCAGACTCTATAGGG - Intergenic
995994998 5:118287205-118287227 TCTAATATCCAGAATCTGTAAGG - Intergenic
996211142 5:120812329-120812351 ATTAATATCCAGAATCTGTAAGG - Intergenic
996645209 5:125805911-125805933 ACTGAAATTCATACTCTTCATGG - Intergenic
997776936 5:136617906-136617928 GCTGATATCCAGAATCTATAAGG - Intergenic
1000132244 5:158310753-158310775 TCTAATATCCAGAATCTGTATGG + Intergenic
1000271949 5:159694341-159694363 ACTAATATCCAGAATCTATAAGG + Intergenic
1000602928 5:163296557-163296579 ACTAATATCCAGACTCTACAAGG + Intergenic
1000823013 5:166008713-166008735 TCTAATATCCAGAATCTGTAAGG - Intergenic
1001161938 5:169326862-169326884 TCTGATATCCAGAATCTATAAGG + Intergenic
1001166214 5:169371064-169371086 ACTAATATCCAGAATCTATAAGG + Intergenic
1001750218 5:174123827-174123849 ACTGATATCCAGAATCTACAAGG - Intronic
1002975769 6:2074388-2074410 ACTGATATCCAAAATGTGCAGGG - Intronic
1003935944 6:10975483-10975505 ACTGAAATCCATACACTCTCAGG - Intronic
1003992997 6:11506134-11506156 TCTAATATCCAGAATCTGTAAGG + Intergenic
1004440542 6:15647114-15647136 ACTAATATCCAGAATCTATAAGG + Intronic
1004614213 6:17274655-17274677 TCTAATATCCAGAATCTGTAGGG + Intergenic
1004766322 6:18731802-18731824 TCTTATATCCAAAATCTGTAAGG + Intergenic
1004949293 6:20650437-20650459 TCTGATATCCAGAATCTATAAGG - Intronic
1005769604 6:29053942-29053964 ACTAATATCCAGAATCTATAAGG + Intergenic
1005920769 6:30398605-30398627 ACTAATATCCAGAATATGTAAGG - Intergenic
1007151357 6:39695419-39695441 ACTAATATCCAGAATCTATAAGG + Intronic
1007815169 6:44517515-44517537 ACTAATATCCAGAATATGTAAGG - Intergenic
1008021272 6:46580615-46580637 TCTAATATCCAGAATCTGTAAGG + Intronic
1008155706 6:48011451-48011473 ACTAATATCCAGAATCTATAAGG - Intronic
1008231911 6:48993372-48993394 ACTAATATCCAGAGTCTATAAGG + Intergenic
1008315545 6:50035452-50035474 CCTAATATCCAGACTCTATAAGG + Intergenic
1008334587 6:50286508-50286530 TCTAATATCCAGAATCTGTAAGG + Intergenic
1008438664 6:51507034-51507056 ACTAATATCCAGAATCTGTAAGG + Intergenic
1008826058 6:55695815-55695837 CCTGATATACATACTATCTATGG + Intergenic
1008890172 6:56479031-56479053 ACTAATATCCAGAATCTGCAAGG + Intronic
1009033234 6:58085682-58085704 TCTAATATCCAGAATCTGTAGGG + Intergenic
1009208843 6:60837457-60837479 TCTAATATCCAGAATCTGTAGGG + Intergenic
1009295693 6:61943762-61943784 ACTAATATCCAAACTATGCAAGG + Intronic
1009547331 6:65036574-65036596 TCTAATATCCAGAATCTGTAAGG + Intronic
1010491567 6:76482828-76482850 ACTAATATCCAGAATCCGTAAGG + Intergenic
1010570757 6:77471437-77471459 TCTAATATCCATATTATGTATGG - Intergenic
1010654690 6:78498259-78498281 TCTAATATCCAGAATCTGTAAGG - Intergenic
1010988691 6:82454808-82454830 TCTGATATCCAGAATCTCTAAGG - Intergenic
1011037387 6:82992520-82992542 GCTGACATCCATATTCTTTAGGG + Intronic
1011103188 6:83747378-83747400 ACTAATATCCAGAATCTGCAAGG + Intergenic
1011106996 6:83793192-83793214 ACTAATATCCAGAATCTATAGGG + Intergenic
1011116780 6:83901903-83901925 ACTGATATCCAGAATATATAAGG - Intronic
1011238738 6:85247545-85247567 TCTAATATCCATAATCTATAAGG - Intergenic
1012169994 6:96004743-96004765 ACTAATATCCAGAATCTATAAGG + Intergenic
1013090229 6:106893814-106893836 AATGGAATCCAAACTCTGTATGG + Intergenic
1013256487 6:108391508-108391530 ACTGATATCCAGAATCTACAAGG - Intronic
1013716838 6:112972160-112972182 TCTGATATCCAGAATCTATAAGG + Intergenic
1013728408 6:113130535-113130557 ACTGATATTAATACTCCCTATGG + Intergenic
1014038602 6:116797669-116797691 ACTTATCTCCAGACTCTGTAGGG - Intronic
1014058827 6:117047551-117047573 ACTAAACTCCATACTCTATACGG - Intergenic
1014108732 6:117596274-117596296 ACTAATATCCAGACTCTACAAGG - Intronic
1014306543 6:119749682-119749704 ACTAATATCCAGAATCTATAAGG - Intergenic
1014330701 6:120060150-120060172 ACTAATATCCAGAGTCTGTAAGG + Intergenic
1014653573 6:124071587-124071609 TCTAATATCCAGAATCTGTAAGG + Intronic
1014869502 6:126575072-126575094 ACTGATTTCCTTACTCTGCTTGG - Intergenic
1014870305 6:126586634-126586656 ACTAATATCCATAATCTACATGG - Intergenic
1015000323 6:128206094-128206116 ACTAAGATGCATACTCTTTAGGG - Intronic
1015048532 6:128810146-128810168 ACTAATATCCAGAATCTATAAGG - Intergenic
1015175432 6:130302209-130302231 ACTAATATCCAGAATCTATATGG + Intronic
1015281444 6:131439078-131439100 ACTAATATCCATAATTTGTAAGG + Intergenic
1015491525 6:133832080-133832102 TCTGATATCCATCATCTATAAGG + Intergenic
1016237165 6:141882089-141882111 ACTCATATCCAGAATCTATAAGG + Intergenic
1016948355 6:149555580-149555602 ACTGATATCCAGAATCTGCAAGG + Intergenic
1017744075 6:157431317-157431339 ACTGAACTCCCCACTCTGTATGG - Intronic
1017762178 6:157578073-157578095 TGTAATATCCATAATCTGTAAGG - Intronic
1017842672 6:158233672-158233694 AGTGATAGCCATATTCTGAATGG + Intronic
1018636894 6:165870211-165870233 ACTAATATCCAGAATATGTAAGG + Intronic
1019264447 7:105536-105558 ACTCATATCCAGAATATGTAAGG + Intergenic
1020971509 7:14947947-14947969 TCTGAAATCCATTCTCTGAAGGG - Intronic
1020974015 7:14983154-14983176 GCTAATATCCACAATCTGTAAGG - Intergenic
1021321145 7:19213521-19213543 TCTCATATTCATACACTGTAGGG - Intergenic
1021370552 7:19839788-19839810 TCTAATATCCAGAATCTGTAAGG - Intergenic
1022524784 7:31029854-31029876 ACTGAAATCCATGCACTGCAGGG - Intergenic
1023720324 7:43086705-43086727 ACTAATATCCATAATCTACAAGG + Intergenic
1024426822 7:49235279-49235301 TCTAATATCCAGAATCTGTAAGG - Intergenic
1027629745 7:80588128-80588150 AATGATAACTATAATCTGTAAGG + Intronic
1027641108 7:80734937-80734959 TCTAATATCCATAATCTATAAGG + Intergenic
1027728611 7:81840547-81840569 TCTGATATCCAGAATCTATAAGG - Intergenic
1027860555 7:83573160-83573182 TCTGATATCCAGAATCTATAAGG + Intronic
1027981046 7:85222914-85222936 ACTAATATCCAGAATCTGCAAGG + Intergenic
1028172228 7:87612140-87612162 ACTAATATCCAGAATCTATAAGG - Intronic
1028189543 7:87829192-87829214 TCTGATATCCAGAATCTATAAGG - Intronic
1028346142 7:89785508-89785530 TCTCATATCCAGAATCTGTAAGG + Intergenic
1028496885 7:91471539-91471561 ACTAATATCCATAATCTGCAAGG - Intergenic
1028532848 7:91857574-91857596 ACAAATACCCATAATCTGTAAGG + Intronic
1028645236 7:93088021-93088043 ATTAATATCCAGACTATGTAAGG - Intergenic
1030242328 7:107342136-107342158 TCTAATATCCAGAATCTGTAAGG + Intronic
1030727971 7:112948657-112948679 ACTAATATCCAGAATCTATAAGG - Intergenic
1031182014 7:118431445-118431467 CCTAATATCCATCATCTGTAAGG - Intergenic
1032729689 7:134627327-134627349 ACTGATTTCCAGATGCTGTAGGG - Intergenic
1032956642 7:136979324-136979346 ACTAATATCCAGAATCTCTAAGG - Intronic
1033690362 7:143730481-143730503 TCTGATATCCAGAATCTGCAAGG - Intergenic
1033797713 7:144867496-144867518 ACTAATATCCAGAATCTATAAGG - Intergenic
1033826053 7:145190522-145190544 ACTAATATCCAGACTCTACAAGG + Intergenic
1034743481 7:153500255-153500277 ACTGATATCCAGAATCTGCAAGG - Intergenic
1035121803 7:156574843-156574865 ACTAATATCCAGAATCTATAAGG + Intergenic
1037154198 8:15679476-15679498 ACTAATATCCAGAATCTATAAGG - Intronic
1037191489 8:16131353-16131375 TCTAATATCCAGAATCTGTAAGG - Intronic
1038173270 8:25158271-25158293 TCTGATATCCAGAATCTGTAAGG - Intergenic
1039113144 8:34062316-34062338 ACTAATATCCAGAATCTGTGAGG + Intergenic
1039270524 8:35875450-35875472 ACTGATATCCAGAATCTACAAGG - Intergenic
1039643735 8:39255605-39255627 ACTAATATCCAGAATCTATAAGG - Intronic
1039679892 8:39721524-39721546 ACTGTTATCCAGAGTCTATAAGG + Intronic
1040360896 8:46663406-46663428 TCTGATATCCAGAATCTATAAGG - Intergenic
1040836795 8:51740707-51740729 TCTAATATCCATAATCTGCAAGG - Intronic
1041745048 8:61199369-61199391 ACTAATATCCAGAATCTATAAGG + Intronic
1041755236 8:61306415-61306437 TCTAATATCCATCATCTGTAAGG - Intronic
1042527544 8:69779918-69779940 ACTGATATCCAGAATTTATAAGG + Intronic
1042943742 8:74133903-74133925 ACTGATATCCAGAATCTATAAGG + Intergenic
1043710557 8:83411995-83412017 ACTGGTATCTATACTATCTATGG + Intergenic
1043988303 8:86720259-86720281 ACTAATATCCAGAATCTGCAAGG + Intronic
1044054317 8:87549404-87549426 ACTAATATCCAAACTCTACAAGG - Intronic
1044881252 8:96725344-96725366 TCTAATATCCAGACTCTATAAGG + Intronic
1045045396 8:98270559-98270581 ACTAATATCCAAAATCTATAAGG - Intronic
1045230322 8:100299840-100299862 ACTGTTATCAATAATTTGTATGG - Intronic
1045589046 8:103572784-103572806 ACTAATATCCAAAATCTATAAGG - Intronic
1046473751 8:114713543-114713565 ACTGATGTCCATACTCTGCATGG + Intergenic
1046596531 8:116267766-116267788 CCTAATATCCAGAATCTGTAAGG - Intergenic
1046827313 8:118705421-118705443 ACTAATATCCAAAATCTATAAGG - Intergenic
1046865309 8:119142727-119142749 CCTAATATCCAGAATCTGTAAGG + Intergenic
1047561404 8:125991190-125991212 ACTAATGTCCATACTCTATAAGG + Intergenic
1047608255 8:126495980-126496002 ACTGATATGCATACTCTGCATGG - Intergenic
1048101348 8:131355602-131355624 TCTAATATCCAGAATCTGTAAGG - Intergenic
1048615090 8:136065414-136065436 TCTAATATCCAGAATCTGTAAGG + Intergenic
1049914356 9:302612-302634 TCTGATATCCAGAATCTATAAGG + Intronic
1050648129 9:7744369-7744391 TCTAATATCCAGAATCTGTAAGG - Intergenic
1050986220 9:12086440-12086462 ATTAATATCCACAATCTGTAAGG - Intergenic
1051549209 9:18310470-18310492 ACTAATATCCAGAATCTATAAGG + Intergenic
1051600950 9:18873178-18873200 ACTAATATCCAGAATCTATAAGG - Intronic
1052242305 9:26288813-26288835 TCTGATATCCAGAATCTATAAGG - Intergenic
1052529681 9:29665775-29665797 ACTAATATCCAGAATCTATAAGG + Intergenic
1054947808 9:70814768-70814790 AATGATATCCATACCCTTGAGGG + Intronic
1055340288 9:75274158-75274180 ACTAATATCCAGAATCTGCAAGG - Intergenic
1055362021 9:75501882-75501904 CCTAATATCCAGAATCTGTAAGG - Intergenic
1055543878 9:77346405-77346427 ACTAATATCCAGAATCTGTAAGG - Intronic
1055656997 9:78460836-78460858 GTTAATATCCATAATCTGTAAGG + Intergenic
1055740660 9:79384871-79384893 ACTAATATCCAGAATCTATAAGG - Intergenic
1055996424 9:82165257-82165279 ACTAATATCCAGAATCTGTAAGG + Intergenic
1056010546 9:82325035-82325057 GCTAATATCCATAATCTATAAGG + Intergenic
1056027072 9:82509872-82509894 ACTGATATCCAGAATCTACAAGG + Intergenic
1056230872 9:84541742-84541764 ACTAATATCCAGAATCTATAAGG - Intergenic
1056312531 9:85354741-85354763 ACTAATATCCAGAATCTATAAGG - Intergenic
1058557825 9:106188806-106188828 ACTAATATCTAGACTCTATAAGG - Intergenic
1058616455 9:106833983-106834005 TCTAATATCCAGAATCTGTAAGG + Intergenic
1061525207 9:131155369-131155391 ACTAATATCCAGAATCTATAAGG - Intronic
1186683693 X:11901979-11902001 ACTAATATCCAGAATCTGTAAGG - Intergenic
1187637281 X:21243684-21243706 ACTAATATCCAGAATCTATAAGG - Intergenic
1188193698 X:27204053-27204075 ATTGACATCCTTACTGTGTATGG + Intergenic
1188591626 X:31843589-31843611 TCTAATATCCATAATCTATAGGG - Intronic
1188805355 X:34581645-34581667 ACTAATATCCAGACTCTAAAAGG + Intergenic
1189176413 X:38962328-38962350 ATTAATATCCAGAATCTGTAAGG - Intergenic
1189444703 X:41069684-41069706 TCTAATATCCAGAATCTGTAAGG - Intergenic
1189878142 X:45458342-45458364 ACTAATATCCAGAATCTATAAGG - Intergenic
1190554604 X:51620779-51620801 ACTAATATCCAGAATCTATAAGG - Intergenic
1191046184 X:56139889-56139911 CCTAATATCCATAATCTGTAAGG + Intergenic
1191891167 X:65943045-65943067 TCTAATATCCATAATCTATAAGG - Intergenic
1191947315 X:66549595-66549617 ACTAATATCCAGAATCTATAAGG + Intergenic
1192038289 X:67589402-67589424 ACTAACATACACACTCTGTAAGG - Intronic
1192307242 X:69974660-69974682 TCTGATATCCAGAATCTATAAGG + Intronic
1192849387 X:74938425-74938447 TCTAATATCCAGAATCTGTAAGG - Intergenic
1193093053 X:77514874-77514896 ACTAATATCCATTATCTATAAGG + Intronic
1193203547 X:78720941-78720963 ACTAATATCCAGAATCTATAAGG + Intergenic
1193275949 X:79588344-79588366 ACAGATATCAATACTATGCATGG - Intergenic
1193354890 X:80507748-80507770 ACTAATATCCAGACTCTATAAGG + Intergenic
1193451350 X:81672019-81672041 ACTAATATCCAGAATCTGCAAGG + Intergenic
1193513897 X:82439442-82439464 TCTAATATCCATATTCTATAAGG + Intergenic
1193517706 X:82490063-82490085 ACTAATATCCAGACTCTATAAGG + Intergenic
1193617225 X:83704212-83704234 ACTAATATCCAGAATCTATAAGG - Intergenic
1193618914 X:83726552-83726574 ACTAATATCCATAATCTACAAGG + Intergenic
1193714481 X:84921646-84921668 TCTGATATCCAACCTCTATAAGG - Intergenic
1193881758 X:86931553-86931575 TCTGATATCCAGAATCTATAAGG - Intergenic
1193976262 X:88123041-88123063 TCTGATATTCAAACTCTATAAGG + Intergenic
1194032477 X:88833721-88833743 ACTAATATCCAGAATCTATAAGG + Intergenic
1194067652 X:89282495-89282517 ACTAATATTCATAATCTATAAGG + Intergenic
1194310198 X:92297026-92297048 TCTAATATCCATAATCTGCAAGG - Intronic
1194402008 X:93449360-93449382 ACTCATATCCAGAATCTATAAGG - Intergenic
1194880394 X:99243673-99243695 ACTAATATCCAGAATCTATAGGG - Intergenic
1195576284 X:106454984-106455006 TCTAATATCCAGAATCTGTAAGG + Intergenic
1195766589 X:108302736-108302758 CCTGTTGTGCATACTCTGTAAGG - Intronic
1196010616 X:110883706-110883728 TCTAATATCCAGAATCTGTAAGG - Intergenic
1196015033 X:110930294-110930316 TCTGATATCCAGAATCTATAAGG + Intergenic
1196620036 X:117811041-117811063 ACTAATATCCAGAATCTGCAAGG + Intergenic
1197086600 X:122483807-122483829 ACTGATATCCAGAATTTATAAGG + Intergenic
1197110501 X:122768359-122768381 ACTGAAATCCAGAATCTGTAAGG + Intergenic
1197132160 X:123018241-123018263 TCTAATATCCAGAATCTGTAAGG - Intergenic
1197441863 X:126501274-126501296 ACTAATATCCAGAATCTGCAAGG - Intergenic
1197475901 X:126924877-126924899 ACCGATATCCAGAATCTATAAGG - Intergenic
1198490437 X:137134723-137134745 GCTGATATCCAGAATCTGCAAGG + Intergenic
1198721079 X:139621460-139621482 TCTAATATCCAGAATCTGTAAGG + Intronic
1198739294 X:139823923-139823945 ACTAATATCCAGAATCTATAAGG + Intronic
1199821116 X:151447852-151447874 ACTGATATCCAGAATTTATAAGG + Intergenic
1199906223 X:152234349-152234371 AATGATATCCAGAATCTATAAGG - Intronic
1200035444 X:153325449-153325471 TCTAATATCCAGAATCTGTAGGG - Intergenic
1200618489 Y:5411313-5411335 TCTAATATCCATAATCTGCAAGG - Intronic
1200621676 Y:5456072-5456094 ACTAATATCCAGAATCTCTAAGG + Intronic
1201183785 Y:11377418-11377440 ACTAATATCCAGAATCTATAAGG + Intergenic