ID: 1091389576

View in Genome Browser
Species Human (GRCh38)
Location 12:117844-117866
Sequence AGGCCAGAAGCCCCTGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 7, 3: 42, 4: 358}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091389576_1091389584 -3 Left 1091389576 12:117844-117866 CCTCCTGCAGGGGCTTCTGGCCT 0: 1
1: 0
2: 7
3: 42
4: 358
Right 1091389584 12:117864-117886 CCTGGATGGTGGCAATCAAGGGG 0: 1
1: 0
2: 1
3: 13
4: 163
1091389576_1091389581 -5 Left 1091389576 12:117844-117866 CCTCCTGCAGGGGCTTCTGGCCT 0: 1
1: 0
2: 7
3: 42
4: 358
Right 1091389581 12:117862-117884 GGCCTGGATGGTGGCAATCAAGG 0: 1
1: 0
2: 0
3: 10
4: 205
1091389576_1091389589 12 Left 1091389576 12:117844-117866 CCTCCTGCAGGGGCTTCTGGCCT 0: 1
1: 0
2: 7
3: 42
4: 358
Right 1091389589 12:117879-117901 TCAAGGGGCCATGGCAGGGGAGG 0: 1
1: 0
2: 3
3: 23
4: 336
1091389576_1091389586 7 Left 1091389576 12:117844-117866 CCTCCTGCAGGGGCTTCTGGCCT 0: 1
1: 0
2: 7
3: 42
4: 358
Right 1091389586 12:117874-117896 GGCAATCAAGGGGCCATGGCAGG 0: 1
1: 0
2: 0
3: 13
4: 131
1091389576_1091389585 3 Left 1091389576 12:117844-117866 CCTCCTGCAGGGGCTTCTGGCCT 0: 1
1: 0
2: 7
3: 42
4: 358
Right 1091389585 12:117870-117892 TGGTGGCAATCAAGGGGCCATGG 0: 1
1: 0
2: 1
3: 20
4: 154
1091389576_1091389587 8 Left 1091389576 12:117844-117866 CCTCCTGCAGGGGCTTCTGGCCT 0: 1
1: 0
2: 7
3: 42
4: 358
Right 1091389587 12:117875-117897 GCAATCAAGGGGCCATGGCAGGG 0: 1
1: 0
2: 0
3: 12
4: 120
1091389576_1091389591 30 Left 1091389576 12:117844-117866 CCTCCTGCAGGGGCTTCTGGCCT 0: 1
1: 0
2: 7
3: 42
4: 358
Right 1091389591 12:117897-117919 GGAGGCTTATGCTGTGTCACTGG 0: 1
1: 0
2: 0
3: 9
4: 147
1091389576_1091389588 9 Left 1091389576 12:117844-117866 CCTCCTGCAGGGGCTTCTGGCCT 0: 1
1: 0
2: 7
3: 42
4: 358
Right 1091389588 12:117876-117898 CAATCAAGGGGCCATGGCAGGGG 0: 1
1: 0
2: 1
3: 20
4: 159
1091389576_1091389582 -4 Left 1091389576 12:117844-117866 CCTCCTGCAGGGGCTTCTGGCCT 0: 1
1: 0
2: 7
3: 42
4: 358
Right 1091389582 12:117863-117885 GCCTGGATGGTGGCAATCAAGGG 0: 1
1: 0
2: 0
3: 10
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091389576 Original CRISPR AGGCCAGAAGCCCCTGCAGG AGG (reversed) Intronic
900237483 1:1599727-1599749 GGGCCAGGCGCCACTGCAGGAGG + Exonic
900266474 1:1759739-1759761 AGGCCAGACAGCCCCGCAGGAGG - Exonic
900301600 1:1980755-1980777 ATGCCTGAAGCCCCTCCACGGGG + Intronic
900500252 1:3001027-3001049 TGGCCAGGAGCCTCTCCAGGGGG + Intergenic
900541137 1:3203504-3203526 AGGCCAGAAGCCCCTGATGGAGG + Intronic
900796675 1:4712332-4712354 GGGCAAGAGGCACCTGCAGGGGG + Exonic
900899993 1:5509782-5509804 ACGGCAGAAGCTCCTGGAGGTGG + Intergenic
900936874 1:5771611-5771633 AGGCCAGATGGCCCGGCATGGGG + Intergenic
901166419 1:7224863-7224885 AGGGCAGCAGCCCATGCAGGTGG - Intronic
901331240 1:8410358-8410380 TAGCCAGAAGCCCAGGCAGGGGG + Intronic
902515262 1:16986546-16986568 GCGCCAGCGGCCCCTGCAGGAGG + Exonic
902872838 1:19324744-19324766 TGACCAGCTGCCCCTGCAGGTGG + Exonic
902979618 1:20113585-20113607 AGCTCTGAAGTCCCTGCAGGTGG - Exonic
903049037 1:20587410-20587432 AGGCCCTCAGCCCCAGCAGGAGG + Intergenic
903180742 1:21603613-21603635 GGGCCAGAAGCCCCTGGTGAGGG + Intronic
903300332 1:22374360-22374382 AGGAGAGCAGACCCTGCAGGGGG + Intergenic
903973714 1:27136086-27136108 GGCCCAGAAGGCTCTGCAGGTGG - Intronic
904261837 1:29291953-29291975 AGACCAGAGCACCCTGCAGGAGG + Exonic
904292423 1:29496787-29496809 AGACCAGAGCCCCCTGCAGGAGG - Intergenic
904982620 1:34519443-34519465 AGACCACAAGGCCCTGGAGGAGG + Intergenic
906062511 1:42958117-42958139 AGCCCGGACGCCCCTGTAGGTGG - Intronic
906295255 1:44645562-44645584 GGGCCAGAAGCCCTGGCAGCAGG - Intronic
906460271 1:46031132-46031154 AGGCCAGCAGCACCCTCAGGAGG + Exonic
906531566 1:46526740-46526762 AGGCCAGTGGGCCCTGCAGCGGG + Intergenic
906556989 1:46721822-46721844 TGACCAGAAGTCCCTGCAGCGGG - Intergenic
907431722 1:54416053-54416075 AGGGCTGGAGCCCCTGTAGGAGG - Intergenic
908605476 1:65793006-65793028 AGGCCAGGAGCCCCGGGAAGGGG - Intronic
910846207 1:91606715-91606737 AGGCCAGACGCCCCACCATGTGG + Intergenic
914849234 1:151301867-151301889 AGGCCAGAAGCTCTTGCCGAAGG + Exonic
915162610 1:153930837-153930859 AGGCCAGATCCCCCAGCGGGTGG - Exonic
915442952 1:155957675-155957697 AGGTCATAAGCACATGCAGGCGG + Intronic
918984951 1:191613558-191613580 ATACCACAAGCACCTGCAGGCGG + Intergenic
919854192 1:201694469-201694491 GGGCAAGAAGCCCCAGCAGCTGG - Intronic
920051662 1:203168079-203168101 AGGCCTGCAGCACCTGGAGGAGG + Exonic
920113324 1:203602274-203602296 AGGCCAGAAGCTTCAGCAGCAGG + Intergenic
921709111 1:218355696-218355718 AGGCCAGAAGCAGCTGCACCAGG - Intronic
921933782 1:220777461-220777483 AGGTCTGAAGTCTCTGCAGGAGG - Intronic
922239121 1:223744008-223744030 AGGCTTTAAGCCCCTGGAGGTGG + Intronic
922364650 1:224852276-224852298 AGCCCAGAAGCCCATGAAGAAGG + Intergenic
923140818 1:231160938-231160960 GGGACAGGAACCCCTGCAGGGGG - Intergenic
923142783 1:231175330-231175352 AGGCAGGAAGACCCTGCAGGGGG + Intronic
923399200 1:233600015-233600037 AGCCCAGAAGAAACTGCAGGTGG - Intergenic
924595550 1:245441946-245441968 GGGCCAGATGCCTCTGCAGTAGG - Intronic
1062950919 10:1502596-1502618 AGGACTGAGGCCCCTGCAAGCGG - Intronic
1066064940 10:31755222-31755244 AGGCCAGAAGCCCATGGGGTGGG - Intergenic
1067684779 10:48459619-48459641 TGGGCAGGAGCCCCTGCAGGAGG + Intronic
1067828691 10:49597628-49597650 GGGCCTGAGGACCCTGCAGGAGG - Intergenic
1068670320 10:59715908-59715930 GGGCTAGCAGCCCCTGAAGGGGG + Intronic
1069905917 10:71731977-71731999 AGGCCACCATCCCCTGTAGGAGG - Intronic
1070556771 10:77534010-77534032 AGGCCAGCAGCCCCTGCCAAGGG + Intronic
1071174573 10:82909615-82909637 AGACCAGAAGCACCAGCAGTAGG + Intronic
1071504770 10:86226031-86226053 AGGTGACAAGACCCTGCAGGTGG + Intronic
1071553448 10:86584958-86584980 AGGCCAGAAGGCACAGCAAGAGG + Intergenic
1071806165 10:89123453-89123475 AGGACAGAACCCCCAGCAGATGG + Intergenic
1072203390 10:93180898-93180920 AGTCCAGAAGCCTCTGAAGCCGG - Intergenic
1073093978 10:100969123-100969145 AGGCCAGAAGGCCCTCCGAGAGG + Intergenic
1073183719 10:101602496-101602518 CAGCCAGCAGCCCCTGCAGTGGG + Intronic
1074060566 10:109961805-109961827 AGGTCACAAATCCCTGCAGGAGG + Intergenic
1074864266 10:117535748-117535770 AGGGGAGAATGCCCTGCAGGTGG - Intergenic
1075336002 10:121609242-121609264 GGGCCAGAAGGCCCAACAGGGGG - Intergenic
1075632353 10:124008429-124008451 AGGCCAGATTTCCCTGCTGGCGG + Exonic
1076241865 10:128914887-128914909 AGCCCAGAAACACCTCCAGGTGG - Intergenic
1076367789 10:129933598-129933620 AGCCCAGCAGCCTCTGCAGGCGG + Intronic
1076711652 10:132339064-132339086 ACGGCAGCAGCCCATGCAGGAGG + Intronic
1076720151 10:132388893-132388915 AGCCCCCGAGCCCCTGCAGGCGG - Intergenic
1076824334 10:132959628-132959650 AGGCCAGGCTGCCCTGCAGGGGG - Intergenic
1076903679 10:133351941-133351963 TGGACAGAACCCCCCGCAGGAGG - Intronic
1077227191 11:1443479-1443501 AGGGCAGAGCCCCCTGCGGGCGG - Exonic
1077332852 11:1990915-1990937 AGGCCAGGAGGCCCAGCAGTGGG - Intergenic
1077377014 11:2209841-2209863 ACCCCAGAGGCCCCTGGAGGAGG + Intergenic
1077420696 11:2448590-2448612 AGGCCAGAGGCCAAGGCAGGTGG + Intronic
1081620852 11:44618533-44618555 AGCCCGGAAGCCCCTACAGAGGG - Intronic
1081688490 11:45059063-45059085 AGGCCAGAAGACCCTGGGGCTGG + Intergenic
1081867396 11:46367211-46367233 AGGGCAGAGGCCCCAGGAGGTGG + Intronic
1082935083 11:58647597-58647619 AGTACAGAAGCCACAGCAGGTGG - Intronic
1083757654 11:64800307-64800329 AGCAGAGAAGCTCCTGCAGGTGG - Exonic
1083989988 11:66240993-66241015 CCGGCAGAAGCCCCTGCGGGCGG - Intronic
1084523028 11:69675986-69676008 AGGCCAGGAGGCTCTGCATGTGG + Intergenic
1084936184 11:72587939-72587961 GGGCCTGGAGCTCCTGCAGGAGG - Intronic
1085253119 11:75156469-75156491 AGGCCACAAGCCCCTGCCTTGGG - Intronic
1087266404 11:96066351-96066373 AGGACAGAAGCTCCTGAAGCGGG + Intronic
1088745924 11:112804989-112805011 AGTCCAGATGCTCCTGGAGGGGG + Intergenic
1088755517 11:112882156-112882178 AGACCAAAAGCCCCTGCATGGGG + Intergenic
1089665138 11:120013546-120013568 GGGCAGGAAGCTCCTGCAGGGGG - Intergenic
1089792921 11:120957318-120957340 TGGCAGGAAGTCCCTGCAGGAGG + Intronic
1090873725 11:130770443-130770465 AGGCCAGCGACCCCTGCAGAGGG + Intergenic
1091280147 11:134377068-134377090 GGGGCAGAAGACCCTGCAGGTGG - Intronic
1202815835 11_KI270721v1_random:46091-46113 AGGCCAGGAGGCCCAGCAGTGGG - Intergenic
1091389576 12:117844-117866 AGGCCAGAAGCCCCTGCAGGAGG - Intronic
1091584238 12:1806809-1806831 AGGACAGAAGCCCCAGCATCTGG - Intronic
1092030102 12:5276781-5276803 AAACAAGCAGCCCCTGCAGGTGG - Intergenic
1092257978 12:6937359-6937381 AGGCCTGAGGGCCCCGCAGGTGG - Exonic
1092768551 12:11875529-11875551 TGGCCACAAGCACCTGTAGGTGG + Intronic
1092930701 12:13312750-13312772 AGGCCAGAGGCACCTGCAGCTGG - Intergenic
1094837679 12:34329763-34329785 ATCCCAGCAGACCCTGCAGGTGG - Intergenic
1096975923 12:55699237-55699259 AGGCCAGGAGCCCAGGTAGGAGG + Intronic
1098604535 12:72373915-72373937 AGGGGAGAAGCCACTGAAGGAGG + Intronic
1099321875 12:81161640-81161662 CAGCCAGAAGCCTCTGCAGCTGG + Intronic
1101436666 12:104670123-104670145 AGGCCAGCAGGCCCTGCAGCAGG - Intronic
1101961758 12:109256106-109256128 AGGGCAGAAGCCCAGGCTGGAGG - Intronic
1102492868 12:113299376-113299398 AGGCCTGAAGCCCAGGCAAGGGG + Exonic
1103433573 12:120907305-120907327 AGGCCAGAAGCCGTTGGAAGTGG + Intergenic
1104390538 12:128387867-128387889 AGGCCAGCTGCCCGTGCAGGCGG + Intronic
1104595342 12:130116751-130116773 GCGCCTGCAGCCCCTGCAGGTGG - Intergenic
1104951921 12:132445000-132445022 AGGCCCGGAGCCTCTGCAGAAGG + Intergenic
1106186662 13:27415770-27415792 TGGCCTCCAGCCCCTGCAGGGGG - Intergenic
1108510168 13:51148646-51148668 AAGCCAGAAGCCCCACCATGTGG - Intergenic
1113095589 13:106660694-106660716 AGACCATGAGCCCTTGCAGGAGG + Intergenic
1114491055 14:23102251-23102273 AGGACAGAAGGCCCTCCTGGAGG + Intergenic
1118696857 14:68394261-68394283 AGCCCAGCAGCCCCTGCAGATGG - Intronic
1118701748 14:68439999-68440021 AGGCCAGAACTCTCTCCAGGAGG + Intronic
1119247400 14:73124244-73124266 ATGTCAGTAGTCCCTGCAGGTGG + Intergenic
1122100127 14:99401971-99401993 AGGCCAGGAGCTCCTGCAGCAGG + Intronic
1122131580 14:99606904-99606926 AGGCCAGAGCCCCCTCCCGGAGG + Intergenic
1122232696 14:100314783-100314805 AGGACAGAATCCCAGGCAGGAGG - Intergenic
1122603352 14:102932014-102932036 AGGCCAGAGGCCCCAGGAAGAGG - Intronic
1122985231 14:105208794-105208816 AGGCCGGGAGCCCCTCCAGCTGG + Intergenic
1123192698 14:106586316-106586338 GCTCCAGATGCCCCTGCAGGAGG + Intergenic
1123456499 15:20431146-20431168 AGGCCAGCAGCTGCTGCAAGAGG + Intergenic
1123661563 15:22569216-22569238 AGGCCAGCAGCTGCTGCAAGAGG - Intergenic
1123770623 15:23524848-23524870 AGGCCAGAAGCTCCTGCATTTGG - Intergenic
1124262638 15:28206293-28206315 AGGCCAGCAGCTGCTGCAAGAGG + Exonic
1124315363 15:28663445-28663467 AGGCCAGCAGCTGCTGCAAGAGG - Intergenic
1124910497 15:33915706-33915728 AGCACAGAAGCCACAGCAGGTGG + Intronic
1129192901 15:73947724-73947746 GGGCCAGAAACTCCTGAAGGTGG + Intronic
1129234743 15:74217415-74217437 AGCAGAGAACCCCCTGCAGGTGG + Intergenic
1129357042 15:74998099-74998121 AGGACAGAAGCCCCCACAGTGGG - Intronic
1129846692 15:78771115-78771137 AGACACTAAGCCCCTGCAGGTGG + Intronic
1129906689 15:79192583-79192605 AGGCAAGCAGAGCCTGCAGGTGG - Intergenic
1130443576 15:83978422-83978444 AGCCCAGCAGCCCCTTCAGGAGG + Intronic
1131092008 15:89630388-89630410 AGGCCCGAAGCACCCGCTGGCGG + Exonic
1131459619 15:92609137-92609159 AGCCCAGCAGCAACTGCAGGAGG - Intergenic
1132933599 16:2470558-2470580 AGGCCAGCATCCCCTGCACCAGG - Intergenic
1133846996 16:9464302-9464324 AGGGCAGAAGGGCATGCAGGGGG + Intergenic
1135929684 16:26726002-26726024 AGCACAGGAGCCCCAGCAGGTGG - Intergenic
1135942110 16:26830905-26830927 AGGGCAGAAGCTGCTGCTGGGGG + Intergenic
1136478626 16:30527561-30527583 CGGCCAGAAGCGCCTTCAGGAGG + Intronic
1137252027 16:46747752-46747774 AGGGCACACGCCCCTGCATGAGG + Exonic
1137260260 16:46821481-46821503 AGCCCAGAAATCCCTGCAGGAGG - Intronic
1137727257 16:50665285-50665307 AGCCCAGAAGCCCCAAAAGGCGG - Intergenic
1137892660 16:52178845-52178867 AGGCCAAATCCCCCGGCAGGTGG + Intergenic
1138502785 16:57458431-57458453 TGATCATAAGCCCCTGCAGGGGG + Intronic
1140415031 16:74768445-74768467 AGTGTAGAAGCCCCTGCAGGTGG + Intronic
1140905988 16:79409557-79409579 AGGCCCGAAGCCCACCCAGGAGG + Intergenic
1141439018 16:84017275-84017297 AAGCCATAAACCCCTGAAGGTGG + Exonic
1141725773 16:85787374-85787396 AGGACAGCGGCCCCTGCAGGGGG - Intronic
1141814810 16:86402372-86402394 AGCACTGAAGGCCCTGCAGGTGG - Intergenic
1141992033 16:87615970-87615992 AGGGAAGAAGAGCCTGCAGGAGG + Intronic
1142218827 16:88842864-88842886 AGGCCAGAAGCACCTGCAGAAGG - Intronic
1142222368 16:88861799-88861821 ACCCCAGAAGCCCTTGCAGCAGG + Exonic
1142364069 16:89640491-89640513 GGAGCAGCAGCCCCTGCAGGCGG + Intergenic
1142429045 16:90016566-90016588 GCACCAGCAGCCCCTGCAGGGGG - Intronic
1142682907 17:1561061-1561083 GGGCCAGAAGCCCCAGGAGTGGG - Intronic
1142890083 17:2937529-2937551 AGGCCAGCAGCACGTGCAGGAGG + Intronic
1144173479 17:12682349-12682371 AGACCAGAAGCCTCTGATGGTGG + Intronic
1144948726 17:18982769-18982791 AGCCCAGGAGCCCCTGGAGTGGG + Intronic
1144998204 17:19285546-19285568 TGCGCAGCAGCCCCTGCAGGAGG - Intronic
1145826291 17:27879587-27879609 CTCCAAGAAGCCCCTGCAGGAGG - Intronic
1147450786 17:40502543-40502565 AGGCCAGAAGCCCTTCCACTGGG - Intergenic
1148086703 17:44997953-44997975 AGCCCAGAGGCCCCTGCAGGGGG + Intergenic
1148411457 17:47471029-47471051 ATGACAGCAGCCCATGCAGGTGG + Intergenic
1150284952 17:63949333-63949355 AGGCCTGCAGCCCCTGCAAGGGG - Intronic
1151237002 17:72727921-72727943 AGGTCAGAAACCCCTGAAGTGGG + Intronic
1152067935 17:78121699-78121721 CGGCCAGCAGCTCCTGCAGGCGG + Exonic
1152078322 17:78171729-78171751 AGGCCAGCACACCCTGCAGGGGG - Exonic
1152234475 17:79131479-79131501 AGGCCTGAGGCTCCTGCGGGTGG - Intronic
1152538633 17:80963858-80963880 AGGCCAGAGAGCCGTGCAGGTGG - Intronic
1152616092 17:81338571-81338593 GGCCCAGAAGCCTCTCCAGGTGG - Intergenic
1153229295 18:2921152-2921174 AGGCCCGATGGCCCTGCAGAAGG + Intronic
1153885093 18:9457391-9457413 AGGCCAGAAGACCCCCCAGAGGG - Intergenic
1154134044 18:11760686-11760708 TGGTAAGGAGCCCCTGCAGGGGG + Intronic
1154297820 18:13165684-13165706 AGCACAGAAGCCGCGGCAGGCGG + Intergenic
1154381280 18:13852144-13852166 AGGCCAGCTGCTCCTGAAGGAGG + Intergenic
1156334928 18:36161720-36161742 GGGACACAAGCCCATGCAGGTGG - Intronic
1157166136 18:45359816-45359838 TGGACAGAAGCCCTTGCCGGTGG - Intronic
1158665320 18:59427608-59427630 AGGCCTTAAGGCCCTGCAAGAGG - Intergenic
1159082444 18:63751028-63751050 AGGCAAAAAGCCCCTGAAGAGGG - Intergenic
1160420921 18:78743323-78743345 AGGCCTGAGGCCTCTGCACGAGG + Intergenic
1160731653 19:644041-644063 AGGACAAAGGCACCTGCAGGTGG + Intergenic
1160779513 19:871698-871720 AGAACATAAGCCCCTGCAGGTGG - Intronic
1160897183 19:1408276-1408298 AGGCCAGGAAGCCCTACAGGCGG - Intronic
1161327301 19:3670034-3670056 GGGCCAGAAGCCTCTGCAGGCGG + Intronic
1161327332 19:3670117-3670139 GGGTCAGGAGCCTCTGCAGGCGG + Intronic
1162384614 19:10353626-10353648 AGGCGAGAAGTCGCTGCAGCTGG - Exonic
1162545005 19:11323989-11324011 TGAGCAGAAGCCCCTGGAGGTGG + Exonic
1162805772 19:13137341-13137363 AGGCCAGGAGCCGCCGCAGTAGG - Exonic
1163152902 19:15425337-15425359 AGCCAAGCGGCCCCTGCAGGAGG - Exonic
1163366402 19:16878242-16878264 AGGCCAGGAGCTCCTGGAAGCGG + Exonic
1163413645 19:17172528-17172550 AGCCCAGAAGCCCATGTGGGAGG + Intronic
1163652346 19:18525465-18525487 AGGCCATAAGCCACTGCACCTGG + Intergenic
1163660687 19:18575329-18575351 AGGACAGAAGACCCCACAGGTGG - Exonic
1163670780 19:18627172-18627194 AGGCCGGAAGCCCCAAGAGGAGG - Intergenic
1164578009 19:29417401-29417423 AGGCCAGAAGCCAGTGCCGCTGG + Intergenic
1165079063 19:33297502-33297524 AGACCAGCAGCTCCTGGAGGAGG + Intergenic
1165908996 19:39212426-39212448 GGTCCAGGAGCCCCTGCGGGTGG + Intergenic
1166104318 19:40589938-40589960 AGGCCAGGAGCCCAGGGAGGAGG + Intronic
1166531966 19:43548128-43548150 CGGCCAGCCGCCCCTCCAGGAGG + Intronic
1166601070 19:44094914-44094936 AGGGCCGAGGCCCCTGCAGCTGG - Intronic
1166943504 19:46383361-46383383 TGGGCAGCAGCCCCTGCAGCCGG + Intronic
1167029957 19:46951767-46951789 AGACCAGGAGCCTCTGCATGGGG - Intronic
1167193706 19:48010914-48010936 AGGGCAGATGCCCCTGTAGGTGG - Intronic
1167499157 19:49835841-49835863 GGGCCAGAAGCTGCTCCAGGAGG - Exonic
1168722104 19:58559795-58559817 TGGCCAGAAGCCACTCCTGGGGG - Intergenic
925048044 2:789543-789565 CAGCCAGAAGCCGCTGCAGAGGG + Intergenic
925081867 2:1076051-1076073 AGAACATAAGCCCCTGGAGGAGG - Intronic
925629219 2:5871716-5871738 TTGGCAGAAGCACCTGCAGGAGG - Intergenic
925762529 2:7199295-7199317 AGGTCAGAAACTCCTGAAGGAGG - Intergenic
925885698 2:8392345-8392367 AGGCCAGAAGCCTCTCAAGGGGG + Intergenic
925885937 2:8393749-8393771 AGGCCAGAAGCCCCTCAAGGCGG - Intergenic
926129745 2:10295375-10295397 AAGTCAGAAGCCCCAGCCGGGGG - Intergenic
926139991 2:10362764-10362786 CAGCCAGAAGCCCCTGCATCAGG + Intronic
929433615 2:41909561-41909583 GGTCCAGAAGATCCTGCAGGGGG + Intergenic
929930756 2:46253860-46253882 AGGCTCGAAGGCCCTGCATGTGG + Intergenic
932589946 2:73059255-73059277 AGGGCAGAAGGCCCAGCAGCCGG - Intronic
932853324 2:75208994-75209016 AGCACAGAAGCCGCAGCAGGTGG - Intergenic
935068980 2:99676895-99676917 AGGCCAGGAGTCCCTCCACGAGG + Intronic
936141415 2:109945320-109945342 AGGCCACAAGCACCTGTGGGAGG - Intergenic
936178104 2:110243268-110243290 AGGCCACAAGCACCTGTGGGAGG - Intergenic
936203278 2:110426163-110426185 AGGCCACAAGCACCTGTGGGAGG + Intronic
936259647 2:110947858-110947880 GGGCCAGGAGACACTGCAGGAGG - Intronic
937182826 2:120011815-120011837 AGGGCAAAAGGCCCTGCAAGGGG - Intergenic
937768241 2:125686673-125686695 AGGAGAGAAGCCCATGCAGCAGG - Intergenic
938119135 2:128621538-128621560 AGGCCTGAAGACCCTTCAGCTGG - Intergenic
940655179 2:156479703-156479725 TGGCCACAAACCTCTGCAGGTGG - Intronic
941657516 2:168159889-168159911 AGGCAGGAAGCCCCTGCACAGGG - Intronic
942605883 2:177690202-177690224 AGGTCAGCAGCCCCTGTAGTAGG - Intronic
944445464 2:199784291-199784313 AGACCAGAATGCCCTGCTGGAGG - Intronic
948163012 2:235840584-235840606 AGGGCAGGAGCCCAGGCAGGAGG + Intronic
948952162 2:241260757-241260779 GGGCAAGAAGACCCTGTAGGTGG - Intronic
949057227 2:241934701-241934723 AGGCCAGCACCTCCTGCATGGGG - Intergenic
1168835098 20:872693-872715 AGGCAGGGAGCCCCTGAAGGGGG + Exonic
1169262417 20:4148689-4148711 AAGCTAGAAGCCCCTGAAGCCGG - Intronic
1169340206 20:4790582-4790604 GGGCCTGAAGCCCCTGCAGGAGG - Exonic
1171967065 20:31538571-31538593 AGGCCACAACACCCGGCAGGTGG - Intronic
1172449480 20:35011725-35011747 TAGCCAGAAGCCCCTGAACGAGG - Intronic
1173162291 20:40662054-40662076 ATGCCAGGGACCCCTGCAGGAGG + Intergenic
1173331636 20:42080382-42080404 GTGCCAGAGGCCCCTGAAGGAGG + Exonic
1174116331 20:48229065-48229087 GGGCTGGAGGCCCCTGCAGGAGG - Intergenic
1174124931 20:48297354-48297376 CAGCCAGAAGCCCCTGCTGAAGG - Intergenic
1174303133 20:49596305-49596327 AGGCCAGCAGTGCCTGCAGGGGG + Intergenic
1175238103 20:57526652-57526674 AGGGGAGAAGGGCCTGCAGGGGG + Intergenic
1175442843 20:59003132-59003154 ACTCCAGAAGCCCAGGCAGGAGG - Intronic
1175945283 20:62555718-62555740 AGGCCTCCAGCCGCTGCAGGAGG - Intronic
1175994494 20:62805977-62805999 TGGACAGAAGCCACAGCAGGAGG - Intronic
1176137997 20:63533466-63533488 AGGCCAGAGGTCCCTGTTGGCGG + Intronic
1176151302 20:63592475-63592497 AGCCCAGGAGTCTCTGCAGGAGG - Intronic
1178366459 21:31992618-31992640 AAGCCAGGAGTCTCTGCAGGCGG + Intronic
1178772155 21:35515549-35515571 AGGCCCTGAGACCCTGCAGGAGG + Intronic
1179624657 21:42642029-42642051 ATGACAGAAGCCACTGGAGGTGG - Intergenic
1180123195 21:45767795-45767817 AGGCCCCAGGCCCCTGCAGGTGG + Intronic
1180796823 22:18609931-18609953 AGGCGACACGCGCCTGCAGGAGG + Exonic
1181224901 22:21385340-21385362 AGGCGACACGCGCCTGCAGGAGG - Exonic
1181253731 22:21549473-21549495 AGGCGACACGCGCCTGCAGGAGG + Exonic
1183385044 22:37509735-37509757 AGGTCAGAAGGACCTGCAGCAGG - Intronic
1183485307 22:38085050-38085072 AGTCCTGGAGCCCCTGGAGGGGG + Exonic
1183719794 22:39556104-39556126 AAGCCAGACAGCCCTGCAGGTGG - Intergenic
1184660218 22:45962180-45962202 AGGGCTGAGGCCGCTGCAGGTGG + Intronic
1184684399 22:46089609-46089631 CTGCCAGCAGCCCCTCCAGGTGG - Intronic
1184960220 22:47923154-47923176 AGGGCAAGAGCCCCTGCATGTGG - Intergenic
1184977086 22:48069993-48070015 ACGCATGAAGCCCCTGCTGGGGG + Intergenic
1185074455 22:48675848-48675870 AAGCCTGAAGGCCCTGCAGGTGG + Intronic
1185077366 22:48690556-48690578 AGGCAGGAAGGGCCTGCAGGAGG - Intronic
1185150018 22:49159039-49159061 AGGCCGGAAGGCCCAGGAGGAGG + Intergenic
949933915 3:9101872-9101894 ATTCCAGAAGCCCCTGCACGTGG - Intronic
950163884 3:10779400-10779422 AGTTCAGGTGCCCCTGCAGGAGG - Intergenic
950585541 3:13889902-13889924 GCACCAGAATCCCCTGCAGGAGG + Intergenic
950709499 3:14804484-14804506 AGGCCAGCCGCCCCTGCTGCTGG + Intergenic
950942397 3:16905967-16905989 AGCCCAAAAGCCTCTCCAGGTGG - Intronic
952522467 3:34175000-34175022 AGCACAGAAGCCACAGCAGGTGG - Intergenic
954187851 3:48932860-48932882 AGGCCAGAGGACCTTGAAGGTGG + Intronic
954388642 3:50257759-50257781 GGGCCTGGAGCCCCAGCAGGGGG + Intronic
954878829 3:53820510-53820532 AGCACAGAAGCCCCTGCGGAAGG - Exonic
960940600 3:122930550-122930572 AGGCCAAAAGCCCCGGACGGTGG + Intronic
961104702 3:124231147-124231169 AGCCCAGAAGCTTCTGCATGTGG + Intronic
966761710 3:183425289-183425311 AGAGCAGAAACCCCTGCTGGAGG + Intronic
967045849 3:185736144-185736166 AGGCCAGCAGCTCCTGCACCTGG + Intronic
967844402 3:194032609-194032631 AGGCCAACTGCCCCTGGAGGAGG - Intergenic
967883167 3:194315717-194315739 GGGCCAGAAGCCGCTCCCGGAGG + Intergenic
968372935 4:11861-11883 TGGCCAGCGGCCCCTGCTGGCGG + Intergenic
968396548 4:243712-243734 GGGCCATATGCCCCTGTAGGAGG - Intergenic
968800826 4:2742378-2742400 CAGCCAGAACCCCCTGCAGAGGG - Exonic
968831205 4:2933809-2933831 AGGCCAGGAGGTCCAGCAGGAGG + Exonic
968938978 4:3628205-3628227 CGGCCAGCATCTCCTGCAGGCGG - Intergenic
969464913 4:7350600-7350622 AGGCCAGGACTCCCGGCAGGCGG + Intronic
970502726 4:16694571-16694593 AGGGAAGAAGGCCTTGCAGGAGG - Intronic
975725087 4:77284123-77284145 AGGCCAGAAGACCCTAGAGTAGG - Intronic
975835903 4:78421966-78421988 AGGCCATGAGCTCCTGGAGGTGG - Exonic
977334470 4:95679090-95679112 AGGACAGAAGTCCCTACAGCAGG - Intergenic
981073070 4:140565559-140565581 ATGACAGAAGGCCTTGCAGGCGG - Intronic
981904179 4:149901974-149901996 ATGCCAGCAGCCCCTGCAAATGG + Intergenic
984853111 4:184170719-184170741 AGGCAAGAATCCACTGCACGTGG + Intronic
984942932 4:184950249-184950271 AGGTCACGATCCCCTGCAGGGGG + Intergenic
985384497 4:189431135-189431157 GGGCAAGAAGAACCTGCAGGTGG + Intergenic
985493463 5:192219-192241 GGGCCAGAAGCTGCTGCACGTGG - Exonic
985556588 5:561613-561635 AGGCCAGAACACCAGGCAGGCGG + Intergenic
985627153 5:995029-995051 AGGCCTGCAGCCCCACCAGGCGG - Intergenic
985631942 5:1018368-1018390 GGGCCAGAAGCCCCTGCTAGTGG - Intronic
985908387 5:2860224-2860246 AGTCCAGATGCCCCTGAAGGAGG - Intergenic
986510483 5:8501426-8501448 AGGCAAGAAGCACCTGCTGCTGG - Intergenic
986912347 5:12574021-12574043 AGCACAGAAGCCCATGGAGGGGG + Intergenic
987086484 5:14474358-14474380 AGGCCAGCAGCTCCGGCAGCTGG - Intronic
987373744 5:17216846-17216868 AGCCCAGACGCGCCTGCAGCTGG + Intronic
991541284 5:67731884-67731906 AAGCCATGAACCCCTGCAGGGGG - Intergenic
993503340 5:88685183-88685205 AGGGTAGAAGCCCATGAAGGGGG - Intergenic
995833418 5:116377818-116377840 AGGCCAGAAGCTCATGGAAGTGG - Intronic
996049172 5:118912409-118912431 AGGCCACAAGGCCCTGCATTTGG + Intronic
998530571 5:142880688-142880710 TGCCCAAAAGCCCCTGCAGGTGG - Intronic
999100986 5:149026132-149026154 AGGACAGAAGAACCTTCAGGAGG - Intronic
999328239 5:150656628-150656650 GCGCCAGAAGCGCCTGCAGCTGG - Intronic
1002187402 5:177460738-177460760 AGGCCAAAAGCCCCTGTGGGGGG - Intronic
1002318756 5:178362568-178362590 AGGCCAGAGTCACCTGCCGGTGG - Intronic
1002522273 5:179798401-179798423 AGACAAGGAGGCCCTGCAGGAGG - Exonic
1002814782 6:669459-669481 AGGCCACAAGGCCATGCTGGAGG + Intronic
1004253637 6:14043199-14043221 AGGCCAGGAGTCCCTGCATGAGG + Intergenic
1006456434 6:34134615-34134637 AACCCAGCAGCCCCTGCATGAGG + Intronic
1006804909 6:36781816-36781838 AGGCCACACGCCTCTGCAGCTGG + Intronic
1007325827 6:41058903-41058925 AGTCCAGAAGGCCCTGCTGAGGG + Intronic
1007383553 6:41505290-41505312 CGGCCAGACGGCCCTGCTGGCGG + Intergenic
1007608153 6:43131116-43131138 AGAACAGAAGTCCCTGCAGTAGG - Intronic
1007710225 6:43818229-43818251 ATGCCAGAAGCCCCTGTGGTTGG + Intergenic
1007716400 6:43858621-43858643 CAGCCTGAAGCCCCTGCTGGTGG - Intergenic
1016569593 6:145497450-145497472 AGCCCAAATGCACCTGCAGGAGG + Intergenic
1017979298 6:159385571-159385593 AGCCCAGAAGCAACTGCAGAGGG - Intergenic
1018624182 6:165761427-165761449 AGTCCAGCAGCCCCTCCATGCGG + Intronic
1019378114 7:706917-706939 AGGGCAGAAGCCCCTGATGGAGG - Intronic
1019616316 7:1964226-1964248 AGTCAAGAAGCCCCTGCAGAAGG - Intronic
1019892383 7:3956623-3956645 AGGACATTGGCCCCTGCAGGCGG + Intronic
1021625092 7:22585417-22585439 AGGACAGAAGCTCCTGCACCCGG - Intronic
1022394450 7:29973461-29973483 AGGCCTGAAGGCCCTGCAACTGG + Intronic
1022510254 7:30930772-30930794 AGTCCAGAAGACCCTGCAGCTGG - Intergenic
1022534268 7:31086047-31086069 CAGCCAGAGGACCCTGCAGGAGG - Intronic
1023347954 7:39290758-39290780 AGGCCTGCAGTCCCTGAAGGAGG - Intronic
1023687287 7:42749525-42749547 AGGCCAGATGACCCTGCACTAGG - Intergenic
1024202404 7:47120569-47120591 AGGTCAGAGACACCTGCAGGTGG - Intergenic
1024208691 7:47185591-47185613 AGGCCACAGGCTCCTGGAGGAGG + Intergenic
1025023673 7:55498883-55498905 AGGCCCAAAGCTCCTGGAGGTGG + Intronic
1025756864 7:64352328-64352350 AGCCCAAAAGCACCTGTAGGAGG + Exonic
1026955770 7:74375766-74375788 AGGGCACCAGCCCCAGCAGGTGG - Intronic
1028882735 7:95898240-95898262 AACCCAGAGGCCCCAGCAGGTGG - Intronic
1029218582 7:98970102-98970124 CGGCCAGAAGCAGCTGCAAGGGG - Exonic
1029459050 7:100685048-100685070 AGGCTTGAAGCACCTGCAGCAGG - Exonic
1029460272 7:100690299-100690321 AGGCCAGAAGCTCATCCTGGAGG + Intergenic
1032078600 7:128847824-128847846 TGGCCGGGCGCCCCTGCAGGTGG + Exonic
1034044747 7:147916028-147916050 AGGGCAGAAGCCCTTGCCTGAGG - Intronic
1034269966 7:149798687-149798709 AGGACAGCAGGCCCTCCAGGAGG - Intergenic
1034282791 7:149865433-149865455 AGGCCCAAAGTCCCTGGAGGAGG - Exonic
1035270823 7:157719004-157719026 GGGCCAGAGACGCCTGCAGGAGG - Intronic
1035443328 7:158921990-158922012 AGTGCTGAAGCCCCTGCAGCTGG + Intronic
1038271757 8:26081322-26081344 AGGCCAGGTGCCTCTGGAGGAGG - Intergenic
1039477122 8:37844936-37844958 CAGCCAGCAGCTCCTGCAGGCGG + Exonic
1040015515 8:42696129-42696151 AGACCACCAGCTCCTGCAGGAGG - Intergenic
1041713271 8:60911819-60911841 GAGCCAGCAGCCCCTGCAGATGG + Intergenic
1042194471 8:66220767-66220789 AGGCAAGGAGATCCTGCAGGTGG + Intergenic
1042995464 8:74693462-74693484 AGCACAGAAGCCACAGCAGGTGG + Intronic
1043326753 8:79061725-79061747 AGGCCACAAGACCCTGTATGTGG - Intergenic
1043889870 8:85643505-85643527 ACGGCAGCAGACCCTGCAGGAGG + Intergenic
1043891408 8:85655413-85655435 ACGGCAGCAGACCCTGCAGGAGG + Intergenic
1043893076 8:85715085-85715107 ACGGCAGCAGACCCTGCAGGAGG - Intergenic
1043895763 8:85736539-85736561 ACGGCAGCAGACCCTGCAGGAGG - Intergenic
1043896916 8:85745269-85745291 ACGGCAGCAGACCCTGCAGGAGG + Intergenic
1043899240 8:85763636-85763658 ACGGCAGCAGACCCTGCAGGAGG + Intergenic
1043900850 8:85775830-85775852 ACGGCAGCAGACCCTGCAGGAGG + Intergenic
1043902814 8:85791105-85791127 ACGGCAGCAGACCCTGCAGGAGG + Intergenic
1043904424 8:85803298-85803320 ACGGCAGCAGACCCTGCAGGAGG + Intergenic
1043906036 8:85815489-85815511 ACGGCAGCAGACCCTGCAGGAGG + Intergenic
1043907644 8:85827679-85827701 ACGGCAGCAGACCCTGCAGGAGG + Intergenic
1044311190 8:90694804-90694826 AGGCCAGATGCCTGTGCTGGAGG + Intronic
1044855238 8:96468581-96468603 TGGCCAGGAACCCCTGGAGGAGG + Intergenic
1044966287 8:97576948-97576970 AGGCCAGAAGACCAATCAGGAGG + Intergenic
1045201729 8:99990329-99990351 AGGCCAGAGTCCCCTGCTAGAGG - Intronic
1045652324 8:104352722-104352744 AGGACATAAGCCCCTCAAGGAGG - Intronic
1047198118 8:122740131-122740153 CGGCCTGAAGCCTCTGCTGGGGG - Intergenic
1048899266 8:139022172-139022194 AGCCCAGAGGCTCCTGCAGAGGG - Intergenic
1049259149 8:141629514-141629536 AGTCCAGCAGGCCCTGCAGAGGG - Intergenic
1049670832 8:143869170-143869192 TGGCCAGCTGCACCTGCAGGAGG + Exonic
1049682077 8:143923781-143923803 CGCCCAGAAGCGGCTGCAGGCGG - Exonic
1049769664 8:144374022-144374044 AGCCCAGCAGGCCCTGCGGGAGG - Intronic
1049978429 9:882149-882171 GAGGCAGAAACCCCTGCAGGTGG + Intronic
1051361611 9:16286083-16286105 AGGCCAGAATTCCCTCCAGAAGG + Intergenic
1051414632 9:16826095-16826117 AAGCCATAATCCCCTGCAGCTGG + Intronic
1053397488 9:37787485-37787507 AGGCCAGAGCCCGGTGCAGGCGG + Intronic
1055909089 9:81326922-81326944 AGGCCTGAAGTCCCTGAAGCAGG + Intergenic
1056080925 9:83093374-83093396 AGCACAGAAGCCCATGGAGGGGG + Intergenic
1056928915 9:90858470-90858492 AGGCCAGATGACCCTGAAGGCGG + Intronic
1057051465 9:91927419-91927441 AAGCCAGAGGACCCTGAAGGGGG + Intronic
1057802206 9:98197362-98197384 AGGCCTCAGGGCCCTGCAGGTGG + Intergenic
1058454789 9:105129015-105129037 AAAACAGAAGACCCTGCAGGCGG + Intergenic
1058973450 9:110103941-110103963 AGGCCAGAAGACGGGGCAGGTGG - Intronic
1059420186 9:114185858-114185880 AGGCCATAAGCACCTGAAGGTGG - Intronic
1060281392 9:122218159-122218181 AGACTGGAAGCCCCTCCAGGAGG + Intronic
1060483236 9:124030230-124030252 AGGCCACAGGCCCCTGCAGCCGG + Intronic
1060597879 9:124858891-124858913 GGGCCCCAGGCCCCTGCAGGTGG + Intronic
1060894781 9:127210632-127210654 AGACCAGATGCTCCTGAAGGAGG - Intronic
1061046336 9:128167052-128167074 AGGGCTGAAGCTCCTGCAGGTGG + Intronic
1061409055 9:130408733-130408755 AGGACAGGAGCCTCTGCATGGGG - Intronic
1061896258 9:133649790-133649812 AGGCCCCAAGGCCCTGCAAGGGG - Intronic
1062109307 9:134773290-134773312 AGCCCAGCAGGCCCCGCAGGAGG - Intronic
1062498945 9:136844186-136844208 GGGTCAGAAGCACCTGCGGGAGG - Intronic
1062503973 9:136863436-136863458 TGGCCAGCAGCCCCTGGAGTCGG + Exonic
1185728013 X:2438390-2438412 AGGCGTGAAGCCACTGCACGTGG - Intronic
1185862482 X:3592214-3592236 TGGCCAGTATCCCCTGCAGGAGG - Intergenic
1189365592 X:40385518-40385540 AGGCCAGAAACCCCTGCACGGGG - Intergenic
1192268169 X:69554924-69554946 AGGCCAGAATGCTCTGCTGGAGG - Intergenic
1192370686 X:70510399-70510421 AGGCCGGAAGCCTTTCCAGGAGG + Intergenic
1192713878 X:73618745-73618767 AGCACAGAAGCCACAGCAGGCGG - Intronic
1193258822 X:79380786-79380808 AGCCCAAAAGCACCTGTAGGAGG - Intergenic
1200058667 X:153474461-153474483 AGGCCACAGGCTCCTGCAAGAGG + Intronic
1201377831 Y:13341549-13341571 TGGCCAGAACCCCCTGCTGACGG + Intronic