ID: 1091390058

View in Genome Browser
Species Human (GRCh38)
Location 12:120711-120733
Sequence CTTTGAGAAAGTAGGGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 292}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091390058_1091390063 17 Left 1091390058 12:120711-120733 CCTGTTTCCCTACTTTCTCAAAG 0: 1
1: 0
2: 0
3: 25
4: 292
Right 1091390063 12:120751-120773 TCAAATCCTGCTCTCATCCATGG 0: 1
1: 1
2: 1
3: 18
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091390058 Original CRISPR CTTTGAGAAAGTAGGGAAAC AGG (reversed) Intronic
900840072 1:5041633-5041655 AAGTGAGAAAGTAGGGAAAGTGG - Intergenic
901292496 1:8135076-8135098 GATTGAGAAAGCAGGGAAATGGG - Intergenic
904172796 1:28603322-28603344 CTTTGAGATGGCAGGGAAAAGGG + Exonic
904505265 1:30947624-30947646 ATTGGAGACAGCAGGGAAACTGG - Intronic
904854708 1:33489127-33489149 CTTTGGGAGAGTAGGGACTCGGG - Exonic
905203543 1:36329878-36329900 CTATGCGAAAGGAGGGGAACTGG - Intergenic
909115350 1:71527308-71527330 CTTTAGAAAAGTAGGGAAACTGG - Intronic
909311654 1:74158217-74158239 TTTGGAGAAAGTGGGGGAACAGG - Intronic
910136415 1:83976765-83976787 TTAAGAGCAAGTAGGGAAACAGG - Intronic
911745392 1:101436383-101436405 TTTTGAGAAGGAAGTGAAACAGG + Intergenic
912729915 1:112092987-112093009 CTCTGAGAAAGTCAGTAAACAGG + Intergenic
914863480 1:151405941-151405963 CTTTGAGGCAGAAGAGAAACTGG - Exonic
916851139 1:168705285-168705307 CTTGGGGAAATTAGGGCAACTGG + Intronic
917443764 1:175089364-175089386 CTTTGAGCATGTTGGGTAACAGG - Intronic
917883685 1:179363842-179363864 CTTTGAAAAATTAGGGTAATGGG + Intergenic
919086739 1:192929520-192929542 ATCTGAGTAAGGAGGGAAACGGG + Intergenic
919204935 1:194409726-194409748 CTTTCAGAAAGGAGTGAGACAGG + Intergenic
919520628 1:198583039-198583061 CATTGAGAAAGCAAGTAAACTGG + Intergenic
920046811 1:203138433-203138455 CATTGAGAAAGTGGGAAAAGAGG + Intronic
920969395 1:210730276-210730298 CTTTTAGAAAGAAGGGAATTTGG - Intronic
921215991 1:212937191-212937213 GCTGGAGAAACTAGGGAAACTGG + Intergenic
921670480 1:217918850-217918872 TGTTGAGAAAGTAGGGAGACGGG + Intergenic
923554075 1:234987020-234987042 CCATGAGAAAGCTGGGAAACAGG - Intergenic
923863890 1:237918840-237918862 CTTTTAAAAATCAGGGAAACGGG + Intergenic
1063550850 10:7031312-7031334 CATTGAGAAATTATGGACACAGG + Intergenic
1063806460 10:9649052-9649074 CTTTAAGAAAGAAGGGTAAGGGG - Intergenic
1065920191 10:30386606-30386628 TTTTGAGAAAGCAGGGGGACTGG + Intergenic
1066619437 10:37329092-37329114 CTTCAAGAAACTAGAGAAACAGG + Intronic
1067720799 10:48726300-48726322 ATTGGAGAAAGCAGGGAAAGAGG + Intronic
1070076153 10:73138452-73138474 CTTTAAGAAAGCAGGGATAAGGG - Intronic
1071552361 10:86576529-86576551 CTTTGAGATTGTGGGAAAACAGG - Intergenic
1071783371 10:88872202-88872224 CTTTTATAAAGTAAGGAAATTGG + Intergenic
1072317067 10:94213500-94213522 CTCTGAGGAGGTAGGGACACAGG - Intronic
1073253268 10:102134653-102134675 CTCTGAGAAAGTAGGGGAGAAGG - Intronic
1074325938 10:112450833-112450855 CTGTGGGAAAGTAAGGAAAAGGG + Intronic
1074415117 10:113260927-113260949 CCTAGGGAAAGGAGGGAAACAGG + Intergenic
1074868017 10:117556082-117556104 CTGGGAGAAAGCAGGGAAGCGGG - Intergenic
1076622506 10:131801084-131801106 CTGTGAGCGAGTAGGGAAGCAGG + Intergenic
1076870826 10:133193222-133193244 CCTTCAGAAATTAAGGAAACAGG + Intronic
1078953144 11:16158256-16158278 CTTTGAGAAGGTACAGAAATTGG - Intronic
1079271212 11:18987592-18987614 CTTGGACAAGGGAGGGAAACAGG + Intergenic
1080812043 11:35714431-35714453 CTTTGATAGAGTAGAGAAAGGGG - Intronic
1081354760 11:42098862-42098884 GGAAGAGAAAGTAGGGAAACAGG - Intergenic
1082038781 11:47667699-47667721 ATTCCAGAAAGTAGAGAAACTGG + Intronic
1085025012 11:73231243-73231265 CTTGGTGAAAGAAGGGAAACTGG + Intronic
1085120809 11:73966230-73966252 CTTTGAGAAGGAAGGGGACCAGG + Exonic
1085582507 11:77667171-77667193 CTTTGAAAATGTAGGCAAAGTGG - Exonic
1086157147 11:83679932-83679954 CTTTGAGAGGGTAGGGAAGGTGG - Intronic
1086830628 11:91558957-91558979 CTCTGGGAAACTAGGGAAAATGG - Intergenic
1087897314 11:103601122-103601144 CTTGGAGAAAGTAGGCAGGCTGG + Intergenic
1091390058 12:120711-120733 CTTTGAGAAAGTAGGGAAACAGG - Intronic
1092057256 12:5518261-5518283 TTTTAAAAAAGTAAGGAAACTGG - Intronic
1092593156 12:9969696-9969718 GTTTGTGAAAGGATGGAAACCGG - Intronic
1092650388 12:10628656-10628678 AAGTGAGAAACTAGGGAAACAGG + Intronic
1093066217 12:14661211-14661233 CTGTCAGAGAGTAGGGACACAGG - Intronic
1093704014 12:22254803-22254825 CTTTGAGTGAGTGGGAAAACGGG - Intronic
1094359726 12:29617275-29617297 CTTTGACAAAGCACGTAAACTGG - Intronic
1095522948 12:43089073-43089095 CTTTGAGTAAGTAGGGAAGGTGG + Intergenic
1096489159 12:52004288-52004310 CTTGGAGAAACTGGGGAAATTGG + Intergenic
1097090052 12:56497646-56497668 CTTTTAAAAATCAGGGAAACAGG - Intergenic
1097515775 12:60603814-60603836 CTTTCTGAAAGTAGAGAAATAGG + Intergenic
1099162918 12:79267364-79267386 CTTTGCCAAAGTTGGAAAACAGG + Intronic
1099902775 12:88733360-88733382 CTTTGAGATAGAAAGGAAAGAGG - Intergenic
1100849464 12:98694481-98694503 CTTTCAAAAAGTAGGGCAAATGG - Intronic
1103445151 12:120989558-120989580 CTCTGAGAAAGCAGGGACCCAGG - Intronic
1103945165 12:124522073-124522095 CTTTCAGGAAGTCGGTAAACTGG - Intronic
1105881356 13:24609037-24609059 CTTTGGGAGAGAAGGGAAGCTGG - Intergenic
1106707970 13:32301692-32301714 CTGTAAGAAAGCAGAGAAACTGG - Intergenic
1107178784 13:37431778-37431800 ATTTCAAAAAGTAGTGAAACAGG - Intergenic
1107419116 13:40229992-40230014 CTCTCAGAAAGTAGTGAAACTGG - Intergenic
1107484185 13:40810724-40810746 CTTTGGGAGAGAAGGGAAGCTGG - Intergenic
1109324235 13:60848558-60848580 CTTTGTGGAAGAAGGGAGACTGG + Intergenic
1110069448 13:71155432-71155454 CTTTAAGAAACTAGGAAAAAAGG + Intergenic
1111552748 13:89836949-89836971 CTTTCAGAAAGTATCCAAACTGG - Intergenic
1113106514 13:106777535-106777557 CTTTGAGAAACTATGGCTACTGG - Intergenic
1113796126 13:113059707-113059729 CATTGGGAAAGTGGGGAGACCGG - Intronic
1114455512 14:22851015-22851037 TCTTGTGAAAGTAGGGAGACCGG + Intergenic
1115535255 14:34366896-34366918 CTTTTACAAAGAAGAGAAACTGG + Intronic
1118046272 14:61974777-61974799 CACTGAGTAAGTAAGGAAACAGG + Intergenic
1119717763 14:76870763-76870785 CCTTGAGAAACTGGGGAGACAGG + Intergenic
1124820759 15:33043964-33043986 CTTTGAGCCTGTAGGGAAAGGGG - Intronic
1127921305 15:63496441-63496463 CGGTGAGAAAGTAAGGAAAGGGG - Intergenic
1129691581 15:77716993-77717015 ATAAGAGAAAGAAGGGAAACAGG + Intronic
1130094916 15:80848727-80848749 CTTTCAGAAGCTGGGGAAACTGG - Intronic
1132400385 15:101501558-101501580 CCTGGTGAAAGGAGGGAAACAGG + Intronic
1132528264 16:428559-428581 CTCTGAGATAGTAGGTAAGCAGG + Intronic
1132967517 16:2666903-2666925 CTTTTAAAAATCAGGGAAACGGG - Intergenic
1134013348 16:10871376-10871398 CTCTGAGAAAGTATGCAAAATGG - Intergenic
1134082191 16:11332665-11332687 CTTTGGGAGAGTAGGGAAGGAGG + Intronic
1135421634 16:22309065-22309087 CTGTGTGAACGCAGGGAAACCGG - Intronic
1138376630 16:56568747-56568769 CTTAGAGGAAGTAGGAAAAGAGG - Intronic
1139609146 16:68042499-68042521 TTTTGAGGATGTAGAGAAACCGG - Intronic
1140047930 16:71454821-71454843 ATTTGGGAAAGCAGGGAGACCGG + Intronic
1140179775 16:72703379-72703401 ATTTGAGATAGAATGGAAACTGG + Intergenic
1140600472 16:76469630-76469652 CCTTCAGAAAGTAGGCAACCGGG - Intronic
1143785592 17:9253263-9253285 CAGTGAGAAGGTAGGGATACGGG + Intronic
1147178225 17:38669872-38669894 CTTTGAGACAGAAGGAAAACAGG + Intergenic
1148103366 17:45106210-45106232 CTTTGAGAAGGAAGGGAAGATGG + Exonic
1149071949 17:52554020-52554042 TTTGGAGAAAGTAAGGAAAGGGG + Intergenic
1149134022 17:53343292-53343314 AGTTGAGAAGGTAGGGAAAGAGG + Intergenic
1149418276 17:56483187-56483209 CTCTGCAAAAGTAGAGAAACTGG - Intronic
1150518891 17:65845568-65845590 ATTTTAGAAAATAGGGAAAGTGG - Intronic
1153357869 18:4157812-4157834 CTGTGAGTAAGTGGGGAAGCTGG + Intronic
1153826118 18:8876461-8876483 CTTGGACAAAGGAGGGAAAGGGG - Intergenic
1153959560 18:10129243-10129265 CTTTGGGAAAGTAGAGATAATGG + Intergenic
1154200738 18:12298563-12298585 CTTTGAAAAATTAGCCAAACTGG + Intergenic
1155595424 18:27480579-27480601 ATTTGGGAATGGAGGGAAACCGG + Intergenic
1157551552 18:48585328-48585350 CTTTTAGAAAGTGGGGAAAGTGG + Intronic
1158016229 18:52787622-52787644 CTTTCAGAAAAGAGGTAAACAGG - Intronic
1158801039 18:60909657-60909679 CAGTGAGAATGTAGAGAAACAGG + Intergenic
1159981402 18:74785584-74785606 TTTTGAGAAAATAGAGAAAAAGG - Intronic
1160053917 18:75461957-75461979 CATTGAGAAAGTAGGGAACATGG + Intergenic
1164918029 19:32067602-32067624 CTTTGACAAAGCTGGGAATCTGG + Intergenic
1165284417 19:34829180-34829202 CTTTCAGAAAGTGGAGAAAGGGG + Intergenic
1167355777 19:49003184-49003206 CTTTGACAAAGAAGGAAACCAGG + Intronic
1167597917 19:50436998-50437020 GTTTAAGAAAGTAGGCAAAACGG + Intronic
1168500941 19:56892641-56892663 ATATGAGAATGTAGGGAAATTGG + Intergenic
925617871 2:5761165-5761187 CTTTGTTTAATTAGGGAAACAGG - Intergenic
927535295 2:23852258-23852280 CTTTCAGAAAATAGAGAAAGAGG + Intronic
927630251 2:24766926-24766948 ATTTGGGAAACTAGGGAAAGGGG + Intronic
928407126 2:31023381-31023403 CTTTGACAATGTAAGGAAAGAGG - Intronic
929138976 2:38650792-38650814 CTTTGAGAAAGTAGTGCTTCAGG + Intergenic
931608157 2:64072449-64072471 CTTTGATAAAATGGGGGAACTGG + Intergenic
931809756 2:65843395-65843417 CTTTGGGCCAGTAGGGAAATGGG + Intergenic
933999027 2:87691279-87691301 TGGTGAGAATGTAGGGAAACTGG - Intergenic
935741876 2:106156394-106156416 CGTTGAGGATGTAGAGAAACTGG + Intronic
936294817 2:111259604-111259626 TGGTGAGAATGTAGGGAAACTGG + Intergenic
936373379 2:111921185-111921207 CCTAGAGAGGGTAGGGAAACAGG + Intronic
937101707 2:119276281-119276303 ATTAGAGAAAGTAGGCAAATAGG - Intergenic
937661772 2:124438170-124438192 CTTTAAGAAAGTAGGCAAAGAGG - Intronic
938326053 2:130403857-130403879 CTCTCTGACAGTAGGGAAACTGG + Intergenic
938363889 2:130717608-130717630 CTCTCTGACAGTAGGGAAACTGG - Intergenic
939085542 2:137714618-137714640 CTTTGAGAAAGAGGGGGAAATGG - Intergenic
939695910 2:145324307-145324329 CTTGGAGAAAGGACAGAAACAGG - Intergenic
939714600 2:145568547-145568569 CTTAGAGAAAGTATGGACAAAGG + Intergenic
939879656 2:147615535-147615557 CTTTGAGAAGGGAGGGGAAAGGG + Intergenic
940636642 2:156305946-156305968 TTTTGAGAAAGGAGAGAAAGAGG + Intergenic
941455054 2:165705236-165705258 CTTAGAGAAAGGAGGGAGAATGG - Intergenic
945405380 2:209441475-209441497 CTTTGGAAAAGAAGGGAAAAAGG + Intronic
946201424 2:218072926-218072948 CTTTTACAAAGGAGGGAAAGTGG - Intronic
947172711 2:227326699-227326721 CTTTGAAAAAGAACTGAAACAGG + Intronic
948224198 2:236296163-236296185 ATTTGAGAAAATAAGCAAACTGG - Intergenic
948259279 2:236590923-236590945 ATTTCAGAAAGAAGGGAAGCAGG + Intergenic
948741072 2:240046340-240046362 CTTTGAGAGATGAGGGAGACTGG - Intergenic
1169503397 20:6183374-6183396 CTTTGAGAAAGCAGAGAAGATGG + Intergenic
1171067723 20:22034971-22034993 CCTTGAGAAAGAAGGGTAAAAGG + Intergenic
1171115311 20:22520361-22520383 CTGTGAGGAAGAAGGGAAGCAGG + Intergenic
1171223986 20:23425293-23425315 CATTGACAAAGTTGGGAAGCTGG + Intergenic
1171888427 20:30680673-30680695 CTTTGAGATCCTAGGTAAACAGG + Intergenic
1172590616 20:36115213-36115235 CTTTGAGTAAGTAAGGGAGCTGG + Intronic
1173333161 20:42092474-42092496 CTTGGAGAAAGTAAAGGAACTGG + Intronic
1173671647 20:44803342-44803364 CATTAAGCAAGTAGGGAAACAGG - Intronic
1176931726 21:14820213-14820235 ATTTGAGTAAATAGGGAAAGCGG + Intergenic
1177033426 21:16011719-16011741 CTTTTAGAAAGGAGAGGAACAGG - Intergenic
1177072463 21:16527735-16527757 TTTTGAGAAAATAGGGAAGAGGG - Intergenic
1177142462 21:17371730-17371752 CTATGAGGAAGAAGAGAAACAGG + Intergenic
1177936594 21:27354710-27354732 CTTTGAGAATTTATGGAATCTGG + Intergenic
1183698739 22:39437987-39438009 GTTTGAGAAGGGAGGGAAAGTGG - Intergenic
1183990125 22:41592275-41592297 CTTTTAGAAAATAGGAAAAGAGG + Intergenic
949916876 3:8971965-8971987 CAGTGAGAAAGGAGGGAAGCTGG + Intergenic
950185574 3:10943379-10943401 CTTTGGGAGAGCAGGGAACCAGG + Intergenic
950801626 3:15556261-15556283 TTTTAAGAAAGTAGGAAACCAGG - Intergenic
952072332 3:29652932-29652954 CTTTTAGAAAGCAAGGAAATGGG + Intronic
952672232 3:35983767-35983789 CTTTGAGAATCTAGGGAAGAAGG - Intergenic
953529014 3:43721967-43721989 TGTTGAGACAATAGGGAAACAGG + Intronic
954922177 3:54200813-54200835 TGTTTAGAAAATAGGGAAACAGG - Intronic
957448324 3:80344114-80344136 GTTTGGGAAAGTTGGGAAGCAGG - Intergenic
957571272 3:81949999-81950021 CTTTGAGGAAGGAGAGAAAAAGG - Intergenic
959289887 3:104460333-104460355 CTCTTAGAAAGTGGGGAAAATGG - Intergenic
959878701 3:111417638-111417660 CTTGGAGCAGGTAGGGGAACTGG + Intronic
960127215 3:114013419-114013441 CTTTTAGAAAGTATAGAAATTGG - Intronic
960127537 3:114016875-114016897 GTTGGATAAAGAAGGGAAACAGG - Intronic
962031928 3:131610105-131610127 ATTTGTGAAAGGAGGGAAAAAGG - Intronic
962897346 3:139728312-139728334 CTGTGAGAAAGCAGGGAAAATGG + Intergenic
963399612 3:144780932-144780954 GTTTGAGAAATAAGGGAATCAGG + Intergenic
963669808 3:148236970-148236992 CATTGAGAGAGTAACGAAACAGG + Intergenic
966790620 3:183666179-183666201 CTTTTAAAAAGTTTGGAAACTGG - Intronic
967252689 3:187559009-187559031 CTTTGAGAAAGCAACAAAACTGG - Intergenic
967575323 3:191083107-191083129 CTTTTAGAAAATAGAGAAATAGG + Intergenic
968386268 4:141558-141580 CATTCAGAAAGGAGGTAAACAGG + Intronic
969197267 4:5573025-5573047 CTTGCAGAAAGATGGGAAACAGG - Intronic
969378028 4:6776040-6776062 CATTGAGAAAATTAGGAAACTGG - Intergenic
970544953 4:17118838-17118860 ATTTGAGAATGTAGGCAAAGTGG + Intergenic
970713977 4:18898913-18898935 CGATGAGAAACTTGGGAAACAGG + Intergenic
975491901 4:74998482-74998504 CTTTAAGTAACAAGGGAAACTGG - Intronic
975593531 4:76024333-76024355 GCTTGAGACAGAAGGGAAACAGG + Intronic
976117824 4:81746774-81746796 CTTTCAGAGAGAAGGGAAAAAGG - Intronic
977473110 4:97467654-97467676 TTATGAGAAAGTAGGCAAATAGG + Intronic
977613340 4:99059734-99059756 CTCAGAGAAAGGAGGGAAAGGGG - Intronic
977751228 4:100612225-100612247 TTTTGAAAAAGTAAGGAAAATGG - Intronic
978526123 4:109667714-109667736 CTTTAAGAAACTAGAGAAAGAGG - Intronic
979749537 4:124261192-124261214 CTGTGAGAATGTGGGGCAACTGG + Intergenic
979771892 4:124536074-124536096 CTTTCAGCCAGAAGGGAAACAGG - Intergenic
980535461 4:134115109-134115131 CTTTGGGAAAGAAAGGAAAGAGG - Intergenic
982666310 4:158268905-158268927 CTTTATGAAAGTAGGGAAGATGG - Intergenic
984462127 4:180051854-180051876 CACTGAGAATGTAGAGAAACTGG + Intergenic
985670661 5:1204973-1204995 CCTTGAAAAAGTAGGAAACCAGG - Intronic
985904515 5:2823087-2823109 CTCTGAGGAAGAAGGAAAACGGG + Intergenic
986775292 5:11008632-11008654 CTTCGAGAAAGTGGGGCAAGGGG - Intronic
988271265 5:29020753-29020775 GCTTGAGAAAGCAGGGAAAGAGG - Intergenic
990170803 5:53047628-53047650 CTTTTACAAATTAGGGAATCTGG + Intronic
990968035 5:61471074-61471096 CTTTGTGAATGAAGGGGAACTGG + Intronic
991555046 5:67886482-67886504 CTTTGAGACAGTATGGAAGATGG - Intergenic
992088359 5:73297894-73297916 GTCTGAGAGAGTAGGGAAAGAGG + Intergenic
993472581 5:88323949-88323971 CTTTCAGAAAGTAAACAAACTGG + Intergenic
993479272 5:88402951-88402973 CTCTCAGAAAGTAGCAAAACTGG + Intergenic
995118291 5:108506740-108506762 TTTTTACAAAATAGGGAAACAGG + Intergenic
995385563 5:111585092-111585114 CTGTGAGAATGCAGGGAAATAGG + Intergenic
995735789 5:115297919-115297941 CTGTGAGAAGGGAGGAAAACCGG + Intergenic
995993882 5:118276181-118276203 CTTTCAGAAAGTAGAGTAAGAGG + Intergenic
996532519 5:124541446-124541468 CTTTGAGAGAGTCAGGACACTGG + Intergenic
996717940 5:126602246-126602268 CGTTTAGAAAGCAGGGAAGCTGG - Intronic
997015128 5:129923744-129923766 CTTTGGGACAGTAGTAAAACGGG + Intronic
998533766 5:142910183-142910205 CTTTGTAAAAGGAGGAAAACTGG - Intronic
999578068 5:153002850-153002872 AATTGAGAAAATAGGGAAATGGG + Intergenic
1002415284 5:179117262-179117284 CTTTGACAAAGGAGGGAGCCTGG + Intronic
1002574402 5:180164286-180164308 CATTAAGAAACTAGGGAAAGAGG - Intronic
1005342080 6:24852422-24852444 CAATGAGAAAGTCTGGAAACTGG - Intronic
1005973656 6:30780664-30780686 ATTAGAGAAAGTAGAAAAACAGG + Intergenic
1006639621 6:35483265-35483287 CTTTGAGAAAGAGGTGGAACAGG + Intronic
1007256169 6:40530571-40530593 CTCTGAGGAAGTTGGGAAAGGGG - Intronic
1008026160 6:46638387-46638409 CTGTGAGAAATTAGGGAATTTGG - Intronic
1008039748 6:46784512-46784534 CTTTCAGAGAGTGGGGAAATTGG + Intergenic
1008185069 6:48378797-48378819 CTTTGATATAGTAGAGAAACTGG - Intergenic
1012805563 6:103888135-103888157 CTTGGAGAAGCTTGGGAAACAGG - Intergenic
1013007708 6:106089350-106089372 CCTTCAGAAAGTAGGGAAAGGGG + Intronic
1013169831 6:107626790-107626812 ATGTGAGAAAGAAAGGAAACTGG - Intronic
1013280371 6:108630664-108630686 CTTAGAGAAAGGAGGTAGACTGG - Intronic
1013300998 6:108804777-108804799 GTTTGAGAAAGGAGGAAAATAGG + Intergenic
1013713257 6:112926692-112926714 CTGTGAGGGAGTAGGGAGACAGG - Intergenic
1014153570 6:118086323-118086345 CTTTGAGAAAGCACAGAAAGTGG - Intronic
1014931027 6:127336463-127336485 CTTTGGGAAAGCAGGGAAATAGG - Intronic
1015412521 6:132910951-132910973 TTTTGAGGAAGTAGGGAATTGGG + Intergenic
1016441520 6:144089346-144089368 CTTTATGAAAGCAGGGAAGCAGG + Intergenic
1017555859 6:155567459-155567481 CTTTGAGAACTCAGGGAAAAGGG - Intergenic
1017565147 6:155675986-155676008 CTTTGTGAAATAAGGGAAAATGG - Intergenic
1018289203 6:162273225-162273247 CTATGAGGGAGTAGGGAAATGGG + Intronic
1018362311 6:163084294-163084316 CTTTGAAAAAGTATGCTAACAGG - Intronic
1019262646 7:90229-90251 CTTTGTGTATGTTGGGAAACAGG + Intergenic
1019932317 7:4231938-4231960 CTTTTACAAAGCAGGGAATCTGG - Intronic
1020597409 7:10225485-10225507 CTCTGAGAAACAATGGAAACAGG - Intergenic
1020684469 7:11275993-11276015 GTTTGAGAAAGAAGGCAAATAGG - Intergenic
1021229052 7:18063486-18063508 CTTTGAGATAGTAGGGGATCCGG - Intergenic
1021675306 7:23074502-23074524 TTTTCAGAAAGTAGGACAACTGG - Intergenic
1022413091 7:30154435-30154457 CTCTAAGGAACTAGGGAAACTGG - Intronic
1023497382 7:40812776-40812798 CCTAGAGGAAGTAGAGAAACAGG - Intronic
1023542501 7:41280748-41280770 CTATGAGGAAGTAAGGAAAGCGG - Intergenic
1024500637 7:50101669-50101691 CTTTGAAAAAGTAGGAAATTAGG - Intronic
1026244008 7:68602305-68602327 ATTTGATGGAGTAGGGAAACTGG + Intergenic
1027112346 7:75450287-75450309 CTCTGAGAAAGCAGGAAAGCTGG + Intronic
1027112351 7:75450319-75450341 CTCTGAGAAAGCAGGAAAGCTGG + Intronic
1027112356 7:75450351-75450373 CTCTGAGAAAGCAGGAAAGCTGG + Intronic
1027284580 7:76634829-76634851 CTCTGAGAAAGCAGGAAAGCTGG + Intergenic
1027284585 7:76634861-76634883 CTCTGAGAAAGCAGGAAAGCTGG + Intergenic
1027284590 7:76634893-76634915 CTCTGAGAAAGCAGGAAAGCTGG + Intergenic
1027284595 7:76634925-76634947 CTCTGAGAAAGCAGGAAAGCTGG + Intergenic
1027284600 7:76634957-76634979 CTCTGAGAAAGCAGGAAAGCTGG + Intergenic
1027657564 7:80949752-80949774 TTTTTAGAAAGTAGAGATACAGG - Intergenic
1027668485 7:81068908-81068930 CATTAAGAATGTAAGGAAACTGG - Intergenic
1030307567 7:108034660-108034682 ATTTGAGACATCAGGGAAACTGG - Intronic
1031182448 7:118435354-118435376 ATTTGAGGAGGTATGGAAACAGG - Intergenic
1031671683 7:124554764-124554786 CTAGGAGAAAGGAGGAAAACGGG + Intergenic
1032721473 7:134553770-134553792 CTGTTAGAAACTATGGAAACTGG + Intronic
1033770678 7:144548245-144548267 TGTTGAGAATGTGGGGAAACTGG + Intronic
1034549015 7:151808677-151808699 CTTTGAGAAGGAAGGTGAACAGG + Intronic
1035870008 8:3127318-3127340 CTTTGAGTAATTAGGGGAACAGG - Intronic
1036191712 8:6677027-6677049 CCTTGAGATAGTGGGGAATCAGG - Intergenic
1039354958 8:36804718-36804740 TTTAGAGAACCTAGGGAAACTGG + Intronic
1039415105 8:37386666-37386688 CTTTGGGAAAGGTGGGAAGCTGG - Intergenic
1041113524 8:54510613-54510635 CTTTCAAAACATAGGGAAACAGG - Intergenic
1041435343 8:57833015-57833037 CTTTTAGAAAATAGTGAAAGGGG - Intergenic
1042915497 8:73871450-73871472 TTTTTAAAAAGTAGTGAAACAGG + Intronic
1043413574 8:80026002-80026024 CCTTGAGAAAGTAAGAAAAAGGG + Intronic
1045102904 8:98863212-98863234 CTTTGTGAAAATAGTGAGACTGG + Intronic
1045636127 8:104192970-104192992 CTTAGAGAAACTAGAGAAACAGG + Intronic
1046374378 8:113357339-113357361 CATTGAGAAAATAGGAAAACTGG + Intronic
1046593271 8:116230631-116230653 GCTTGAGAAAGAAGGGACACTGG + Intergenic
1047907728 8:129490744-129490766 CTTTGAACAAACAGGGAAACTGG + Intergenic
1048716203 8:137273163-137273185 CTTTGAAAAATTAGGGTGACTGG - Intergenic
1050399459 9:5235956-5235978 CTTTAAGAAAGTACACAAACTGG + Intergenic
1050801790 9:9624677-9624699 GTTTGAGAAAGTAAGCAAACTGG - Intronic
1051676121 9:19560149-19560171 CTTTGAAAAGGTATGAAAACAGG + Intronic
1051775244 9:20624873-20624895 CTTTGAGGAAGGAGGGGTACTGG - Intergenic
1052055646 9:23904354-23904376 CTTTGAGAAACTAGTGAAATTGG - Intergenic
1052141814 9:24994705-24994727 CTTTTAGAAAGAAGGAACACTGG + Intergenic
1053484805 9:38443830-38443852 ATTTTACAAAGTAGGGAAAAAGG + Intergenic
1054998017 9:71414403-71414425 CTTTGTGAAAGGAAGGAAAAAGG - Intronic
1059033789 9:110731434-110731456 CTTTGAGAAGGGAGGAAGACTGG + Intronic
1059353002 9:113678732-113678754 CCTTGGGAAAGGAGGCAAACTGG + Intergenic
1059646856 9:116276499-116276521 CTTTGTGAAATTAGGGAGACTGG + Intronic
1059937527 9:119325964-119325986 CTATTATAAAGTTGGGAAACAGG - Intronic
1059965079 9:119605863-119605885 CTATCAGAAAGTAGGGAATAAGG + Intergenic
1186033671 X:5396942-5396964 TTTTGAGAAAGTGGATAAACTGG - Intergenic
1186290517 X:8092533-8092555 CTTTTAGAATGTAGGCAAAGAGG - Intergenic
1186684111 X:11906446-11906468 CTTTGAAAATGGAGGGAAATTGG - Intergenic
1186712734 X:12217047-12217069 GTTTGTGAAAGGAGGGAACCAGG + Intronic
1187041695 X:15603182-15603204 CTTTGAGAAGCAAGGGAAAAGGG + Intergenic
1188369699 X:29353562-29353584 CTTAGAAACAATAGGGAAACAGG + Intronic
1188590998 X:31834834-31834856 TTGAGAGAAAATAGGGAAACAGG + Intronic
1189449204 X:41111543-41111565 CTATGAGAAAATAGGGTAGCTGG + Intronic
1190265465 X:48825283-48825305 CAATGAGACAGTGGGGAAACAGG - Intergenic
1192823710 X:74672132-74672154 TTTTAAGAGTGTAGGGAAACTGG - Intergenic
1193720487 X:84979813-84979835 CTTTGAGGAAGAAGGTAAAGAGG + Intergenic
1195938066 X:110144027-110144049 TTTTGAGAGAGATGGGAAACAGG + Intronic
1198388763 X:136152393-136152415 CTTGGAGAAAGGAAGGTAACTGG + Intronic
1198681913 X:139192005-139192027 TTAGGAGAAAGTAGGGAAGCAGG - Intronic
1199167453 X:144693630-144693652 TTTTGAGATATTAGGAAAACTGG - Intergenic
1199556834 X:149118484-149118506 TTTTGTGAAAGTAGAGGAACTGG - Intergenic
1199611084 X:149614656-149614678 CTTTGAGAAAGTAAGAAAATTGG + Intronic
1199910056 X:152276913-152276935 CTTTGAGGAGGGAGGGAAACAGG + Intronic
1200744481 Y:6891701-6891723 CTGTTAGAAACTAGGGAAACTGG + Intergenic
1201491277 Y:14544477-14544499 CTTTGAGAAAGTCGTCATACTGG + Intronic
1201638673 Y:16154579-16154601 TTTTGAGAAAGTGGGTAAACTGG + Intergenic
1201794411 Y:17879403-17879425 CTTTCAGAAACTTGAGAAACTGG - Exonic
1201807143 Y:18026582-18026604 CTTTCAGAAACTTGAGAAACTGG + Exonic
1202093081 Y:21214462-21214484 TTGTGTGGAAGTAGGGAAACAGG + Intergenic
1202355787 Y:24047202-24047224 CTTTCAGAAACTTGAGAAACTGG - Exonic
1202514991 Y:25622907-25622929 CTTTCAGAAACTTGAGAAACTGG + Exonic