ID: 1091391621

View in Genome Browser
Species Human (GRCh38)
Location 12:129564-129586
Sequence GGACCTGCATGCTCACTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 155}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091391621_1091391628 4 Left 1091391621 12:129564-129586 CCAAGGAGTGAGCATGCAGGTCC 0: 1
1: 0
2: 0
3: 11
4: 155
Right 1091391628 12:129591-129613 GGGGAGCCCTTTAGGAATAGAGG 0: 1
1: 0
2: 0
3: 9
4: 102
1091391621_1091391625 -4 Left 1091391621 12:129564-129586 CCAAGGAGTGAGCATGCAGGTCC 0: 1
1: 0
2: 0
3: 11
4: 155
Right 1091391625 12:129583-129605 GTCCCTTTGGGGAGCCCTTTAGG 0: 1
1: 0
2: 1
3: 9
4: 113
1091391621_1091391632 11 Left 1091391621 12:129564-129586 CCAAGGAGTGAGCATGCAGGTCC 0: 1
1: 0
2: 0
3: 11
4: 155
Right 1091391632 12:129598-129620 CCTTTAGGAATAGAGGGCCTAGG 0: 1
1: 0
2: 1
3: 13
4: 112
1091391621_1091391629 5 Left 1091391621 12:129564-129586 CCAAGGAGTGAGCATGCAGGTCC 0: 1
1: 0
2: 0
3: 11
4: 155
Right 1091391629 12:129592-129614 GGGAGCCCTTTAGGAATAGAGGG 0: 1
1: 1
2: 0
3: 3
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091391621 Original CRISPR GGACCTGCATGCTCACTCCT TGG (reversed) Intronic
900354489 1:2253724-2253746 GGACCCGCAGCCTCACTCCCAGG - Intronic
902030105 1:13416125-13416147 GGCCCTGCCTCCTCACTGCTTGG + Intronic
902548535 1:17205601-17205623 GGCCCTGCATTCTGACACCTAGG + Intronic
902896922 1:19485525-19485547 TGACCCGGATGTTCACTCCTGGG - Intronic
903856698 1:26342133-26342155 GGGCCTGCATGCTGGCTCCTGGG + Intronic
906559514 1:46745967-46745989 AGAACTGCCTGCTCATTCCTTGG - Intergenic
907615534 1:55921006-55921028 GCACCTCCATGCCCACCCCTTGG + Intergenic
913327906 1:117643649-117643671 GATCCTGCAATCTCACTCCTTGG - Intergenic
914491199 1:148151688-148151710 GGACCTGCGGGCTCACAGCTGGG - Intronic
916003682 1:160639800-160639822 GGCCCTGCATGCCCAGTCCGTGG + Intronic
916166548 1:161971237-161971259 GGACCTGCCCGCCCACTCCCAGG - Intergenic
916780524 1:168022834-168022856 GGCCCTGCTTACTCACTGCTTGG + Intronic
916853937 1:168730546-168730568 GAACCAGCAATCTCACTCCTAGG - Intergenic
918443154 1:184588876-184588898 GGCCCTGGAAGCGCACTCCTGGG + Intronic
921757825 1:218880375-218880397 GGCCCTTCATGCTCACTCTGCGG - Intergenic
922163039 1:223092370-223092392 GGCCCTGCATGCTATCTGCTAGG + Intergenic
923701175 1:236301734-236301756 TCACCTGCATGCTCCCTCCTGGG + Intergenic
924642941 1:245850891-245850913 GGGCCAGCATGCTCAGGCCTTGG - Intronic
1062819418 10:523094-523116 GTCCCTGCATCCTCACTCCAGGG - Intronic
1062819448 10:523281-523303 GTCCCTGCATCCTCACTCCAGGG - Intronic
1062819479 10:523473-523495 GTCCCTGCATCCTCACTCCAGGG - Intronic
1062819489 10:523536-523558 GTCCCTGCATCCTCACTCCAGGG - Intronic
1062819499 10:523600-523622 GTCCCTGCATCCTCACTCCAGGG - Intronic
1063990035 10:11551107-11551129 TGACCAGCAATCTCACTCCTAGG + Intronic
1064148441 10:12843391-12843413 GGAGCTGGATGATGACTCCTGGG - Intergenic
1066526760 10:36288611-36288633 TGATCAGCAAGCTCACTCCTAGG - Intergenic
1068150717 10:53126878-53126900 GGACGTGCTTGCTTCCTCCTCGG + Intergenic
1068903370 10:62295675-62295697 GGTCCAGCAATCTCACTCCTAGG + Intergenic
1069695103 10:70380749-70380771 GGACCAGGATGCTCACTCTGAGG - Intronic
1070157937 10:73847839-73847861 GGCCCTGGATGCCCATTCCTGGG + Intronic
1070281429 10:75051610-75051632 GGACATCCATCCTTACTCCTGGG + Intronic
1071058526 10:81541078-81541100 GAACCAGCAGTCTCACTCCTGGG + Intergenic
1071971328 10:90910705-90910727 GGACCTGTGTGTTCTCTCCTGGG + Intergenic
1074415316 10:113262307-113262329 GGACCTGCATTCCTACTTCTGGG + Intergenic
1075782741 10:125027351-125027373 GGACCGGCCGGCTGACTCCTGGG + Exonic
1076539930 10:131207372-131207394 GGCCCTGCAGGCTCCCTCCTGGG - Intronic
1077339969 11:2021882-2021904 GGGCCTGCGTGCTCTCCCCTAGG - Intergenic
1078100193 11:8325887-8325909 AGACCTGCATGCAGGCTCCTGGG + Intergenic
1083441208 11:62677923-62677945 AGACCTGGCTGCTAACTCCTCGG + Exonic
1088597290 11:111449952-111449974 TGTCCTGCATGCTCCCTCTTTGG - Intronic
1089023439 11:115242207-115242229 GGGCCTGCATTCTCACACCTGGG - Intronic
1089630956 11:119783808-119783830 TGACCTGCAGGCTGTCTCCTGGG + Intergenic
1090081165 11:123613704-123613726 GGAGCTGCATGCCCACACCAAGG + Intronic
1202822954 11_KI270721v1_random:77071-77093 GGGCCTGCGTGCTCTCCCCTAGG - Intergenic
1091391621 12:129564-129586 GGACCTGCATGCTCACTCCTTGG - Intronic
1105305991 13:19169625-19169647 GGACCTGCATGCAGCCTCCCTGG + Intergenic
1105984355 13:25550603-25550625 GCACCTGCCTTCTCACTGCTGGG - Intronic
1112730648 13:102357294-102357316 ACACCTGCATGCACACTCCAGGG + Intronic
1113564149 13:111308527-111308549 GGGCCTTCCTGCTAACTCCTGGG + Intergenic
1122217120 14:100211984-100212006 GGACTTGCAGGTTCACCCCTCGG + Intergenic
1122699140 14:103575542-103575564 GGACCTACATCCTCACGCATTGG - Intronic
1125737274 15:41935463-41935485 TACCCTGCATTCTCACTCCTAGG - Intronic
1125758493 15:42081810-42081832 TGAGCTGCAGCCTCACTCCTGGG + Exonic
1128201201 15:65809631-65809653 GGCCCAGCACTCTCACTCCTAGG - Intronic
1128968726 15:72087121-72087143 GGACCTGCATCATAGCTCCTGGG - Intronic
1130202413 15:81844255-81844277 GGATATCCATTCTCACTCCTCGG - Intergenic
1131727222 15:95239805-95239827 TGACCTGCAGGCACACACCTGGG + Intergenic
1140957103 16:79876191-79876213 GGTCCTGGATCCTGACTCCTGGG - Intergenic
1141145506 16:81526971-81526993 CGCCCTGTGTGCTCACTCCTGGG - Intronic
1141592161 16:85076600-85076622 GGACCCGCGTGCTCACTCTTGGG + Intronic
1142722136 17:1783523-1783545 AGACCTGGATTCTCATTCCTAGG - Intronic
1143804854 17:9417865-9417887 GGGGTTGCATGCTCACTCCACGG + Intronic
1146382129 17:32338752-32338774 GGACCTGTATGCTAACTTCACGG + Intronic
1148349348 17:46928499-46928521 GGTCCTCCATGATCAGTCCTCGG - Intronic
1149657659 17:58318839-58318861 GGACCTGAATGGTCAGACCTAGG - Intronic
1149992312 17:61389995-61390017 GGCCCTGCCTGCTCCTTCCTCGG + Intronic
1151823736 17:76512171-76512193 GGACCCTCATCCTAACTCCTAGG + Intergenic
1158519214 18:58156753-58156775 TCTCCTGCATGCTCGCTCCTTGG + Intronic
1158534753 18:58297549-58297571 GGGCTTGGATGCTCACTGCTGGG - Intronic
1159781752 18:72668138-72668160 GGAGCTGCATCCTCACAGCTCGG - Intergenic
1160765839 19:807329-807351 GGAGCTGCACGCGCGCTCCTGGG + Intronic
1166095957 19:40539314-40539336 GGACCTCAATGCTCACCCCCTGG + Intronic
1166539249 19:43594739-43594761 GGACCTCCATGGTCGCACCTAGG + Intronic
1167675497 19:50882183-50882205 GCTCCTGCATGCTGCCTCCTTGG - Intergenic
1168246771 19:55116539-55116561 TGACCTGCATTCTCTCCCCTGGG - Intronic
925073386 2:988676-988698 TGACCAGCAGGCACACTCCTGGG - Intronic
925896843 2:8478795-8478817 GGACTTACATTCTCACACCTTGG - Intergenic
926273421 2:11385420-11385442 GAACCAGCCTGCTCACACCTTGG - Intergenic
926631301 2:15138562-15138584 GGACCTGGAGGCCAACTCCTGGG + Intergenic
927650805 2:24912534-24912556 ACACATGCGTGCTCACTCCTGGG - Intronic
928027345 2:27751201-27751223 GGACCTGCATCCTGAATCCCAGG + Intergenic
931709747 2:64978250-64978272 TGCCCTGCATGATCATTCCTGGG - Intergenic
932076837 2:68672231-68672253 GGACTTGCAAGTTCACTGCTCGG - Intergenic
936974381 2:118204653-118204675 GGACCTTCCTGCTGCCTCCTGGG + Intergenic
945203815 2:207310724-207310746 CCTCCTGCATGCTCACTCCGTGG + Intergenic
946341655 2:219073503-219073525 GGACAGGCATGCTCCCTGCTTGG - Intergenic
947875788 2:233467541-233467563 TGCCCTGCCTGCTCCCTCCTGGG + Intronic
948017090 2:234699702-234699724 GGCCCTGCCTGCTCAGGCCTGGG + Intergenic
1168927620 20:1595723-1595745 GAAGCTGCAAGCTCAATCCTTGG - Intronic
1170626441 20:18033666-18033688 TTTCCTGCATGCTCGCTCCTGGG + Intronic
1171144598 20:22770642-22770664 GGCCCAGCTTCCTCACTCCTGGG + Intergenic
1172385943 20:34534315-34534337 AGGCCTGCTGGCTCACTCCTGGG - Intronic
1172643252 20:36454624-36454646 GGACCCGATTGCTCACTCCTTGG - Intronic
1172882033 20:38208370-38208392 GTACCTGAATCCTCACCCCTAGG + Intergenic
1175068443 20:56310902-56310924 GGACCTGCAATCCCACTTCTGGG - Intergenic
1175468754 20:59210674-59210696 GGTCCTGCACGCTCACCCCATGG + Intronic
1176308846 21:5139049-5139071 GGACCTGCATTTTTACTCTTAGG + Intronic
1177556566 21:22696730-22696752 GGTCCAGCAAGCTCACTGCTGGG - Intergenic
1179522973 21:41957199-41957221 AGAGCTGCAGTCTCACTCCTTGG - Intergenic
1179639767 21:42739409-42739431 GGTCCTGCCTCCTCACTCCCTGG - Intronic
1179800607 21:43810027-43810049 GCACATGCATGCCCACTCCTGGG - Intergenic
1179848216 21:44122984-44123006 GGACCTGCATTTTTACTCTTAGG - Intronic
1180653655 22:17400556-17400578 GGAGCTGCATTCTGACTCCCAGG + Intronic
1183385265 22:37510489-37510511 AGACCTGCTCCCTCACTCCTGGG + Intronic
1184455036 22:44605270-44605292 GGCCCCGCATGCTCCCTGCTGGG + Intergenic
1184639811 22:45864572-45864594 GGAGCTGCTGGCTCACACCTGGG + Intergenic
1184951275 22:47844105-47844127 GGACCGGCATGAGGACTCCTTGG + Intergenic
1185061711 22:48610471-48610493 GGACCTTCATGCTGGCTCCCGGG + Intronic
1185231586 22:49686981-49687003 GGAGCTGCATCCTTCCTCCTCGG + Intergenic
950192134 3:10984439-10984461 GGACCTGCAATCCCACTCCTAGG + Intergenic
953488240 3:43323588-43323610 GGCCCAGCAAACTCACTCCTAGG + Intronic
961649696 3:128411189-128411211 GGACGTGCATGCCCACACCTTGG - Intergenic
962251549 3:133839066-133839088 TGCTCTGCATGCTCACACCTAGG + Intronic
968286257 3:197510492-197510514 GGGTCTGCATGATCACTTCTTGG - Exonic
968472160 4:787131-787153 CGACCTGCATTCACACTCCCGGG + Intronic
973229375 4:47824408-47824430 GGACCTGCAAGATCTCACCTGGG - Intronic
974997455 4:69178887-69178909 GGACCTGCATGCACACTAGAGGG - Intronic
975002310 4:69239793-69239815 GGACCTGCATGCACACTAGAGGG - Intergenic
975010419 4:69343835-69343857 GGACCTGCATGCACACTAGAGGG - Intronic
987660768 5:20872447-20872469 CGAGCTGCATGCTCAATCCCTGG - Intergenic
988762876 5:34333238-34333260 CGAGCTGCATGCTCAATCCCTGG + Intergenic
994899674 5:105755438-105755460 GAACTTTCATGCTCACTCCATGG - Intergenic
995785000 5:115818507-115818529 GGCCCAGCAATCTCACTCCTAGG - Intergenic
1001513175 5:172337742-172337764 GGATCTCCAGGCCCACTCCTGGG + Exonic
1002463529 5:179389221-179389243 GTACCTGCATTCTCTCTGCTGGG - Intergenic
1003442056 6:6151949-6151971 TGACCTGCATTCTCTCTCTTAGG - Exonic
1009035477 6:58112727-58112749 GGCCCAGCAGTCTCACTCCTAGG + Intergenic
1009211293 6:60866319-60866341 GGCCCAGCAGTCTCACTCCTAGG + Intergenic
1012534194 6:100276098-100276120 GGACATGCATGCTAAGTACTTGG + Intergenic
1014006606 6:116426601-116426623 GGTCCCGCTTGCTCACTCCCTGG + Exonic
1015204142 6:130616046-130616068 GGAAATGCATGCCCACTCCCTGG - Intergenic
1016934018 6:149435818-149435840 AGAGCTGCCTCCTCACTCCTGGG + Intergenic
1017429606 6:154358170-154358192 GGACCTGCTTCCTCGTTCCTAGG - Intronic
1018134656 6:160767509-160767531 GCAGCTGCACGCTCACTCCCAGG + Intergenic
1021773153 7:24025284-24025306 GGACCAGCATGCTCATCCCGGGG - Intergenic
1023686830 7:42744555-42744577 GAACCAACATGCTCTCTCCTGGG - Intergenic
1024631639 7:51253362-51253384 GGCCCTGCAAGCCTACTCCTGGG + Intronic
1028044671 7:86102590-86102612 TGAACTCCATGCTCAATCCTCGG + Intergenic
1032158962 7:129495512-129495534 GGTCTTGCATTCTCACTGCTAGG + Intergenic
1043174509 8:77007612-77007634 GATCCTGCATTCTCACTGCTAGG - Intergenic
1048574161 8:135677916-135677938 GGCCCAGCATGGTCACTCCAAGG - Intergenic
1048981046 8:139703537-139703559 GGACCTGCAGGCTCCTTGCTGGG - Intergenic
1049207511 8:141370386-141370408 AGACCTGCAGGCTCCTTCCTGGG + Intergenic
1049574908 8:143385488-143385510 AGTCCTGCTTGCGCACTCCTGGG + Intergenic
1054721620 9:68609566-68609588 GGTCCCGCTTGCTCACTCCCTGG + Intergenic
1055330447 9:75177934-75177956 GAACAAGCATGCTCTCTCCTAGG - Intergenic
1056101401 9:83303541-83303563 GGACCAGCATCATCACTCCCGGG - Intronic
1056788961 9:89613121-89613143 GGGCCCGCAGGCTGACTCCTCGG - Intergenic
1057867821 9:98695235-98695257 GTACCTGCAGGCTCTGTCCTGGG + Intronic
1057868173 9:98697881-98697903 GGACCCGCATGCCCACTCTGGGG - Intronic
1061533451 9:131232624-131232646 GAAGCTGCATGCTAACCCCTGGG + Intronic
1061852094 9:133422343-133422365 GGACAGGCCTGCTCACTACTGGG - Exonic
1062205204 9:135332678-135332700 GAACCTCCATGCTCACACCTAGG + Intergenic
1186388902 X:9138384-9138406 GATCCTGCAATCTCACTCCTGGG + Intronic
1187188925 X:17014299-17014321 GGACCTCCTAACTCACTCCTGGG + Intronic
1187289892 X:17942839-17942861 AGCCCTGCATGCTCACTGCAAGG - Intergenic
1190411388 X:50140349-50140371 TCACCTGCATCCCCACTCCTAGG - Intergenic
1193508744 X:82373312-82373334 GGAAGTGCATGCTCAGTCCCTGG - Intergenic
1198423097 X:136487499-136487521 TGACCTGAATGATCACTCCTTGG + Intergenic
1199858621 X:151780158-151780180 GAAACTGCCTTCTCACTCCTGGG - Intergenic
1199978645 X:152908898-152908920 CACCCTGCATGCACACTCCTGGG - Intergenic
1200691347 Y:6308068-6308090 GGACCTTGCTGCTCATTCCTTGG + Intergenic
1201043925 Y:9866648-9866670 GGACCTTGCTGCTCATTCCTTGG - Intergenic
1202169269 Y:22023755-22023777 GGACTGGGATGATCACTCCTGGG + Intergenic
1202222092 Y:22562610-22562632 GGACTGGGATGATCACTCCTGGG - Intergenic
1202321023 Y:23633057-23633079 GGACTGGGATGATCACTCCTGGG + Intergenic
1202549744 Y:26036999-26037021 GGACTGGGATGATCACTCCTGGG - Intergenic