ID: 1091391984

View in Genome Browser
Species Human (GRCh38)
Location 12:131333-131355
Sequence CCAGGGAGTGGGGGGTCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 0, 2: 6, 3: 36, 4: 363}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091391984_1091392003 25 Left 1091391984 12:131333-131355 CCCAGAGACCCCCCACTCCCTGG 0: 1
1: 0
2: 6
3: 36
4: 363
Right 1091392003 12:131381-131403 TCTGCTCTCTGACCTGGCCCTGG 0: 1
1: 0
2: 1
3: 41
4: 358
1091391984_1091392002 19 Left 1091391984 12:131333-131355 CCCAGAGACCCCCCACTCCCTGG 0: 1
1: 0
2: 6
3: 36
4: 363
Right 1091392002 12:131375-131397 CCTCTCTCTGCTCTCTGACCTGG 0: 1
1: 1
2: 2
3: 53
4: 484

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091391984 Original CRISPR CCAGGGAGTGGGGGGTCTCT GGG (reversed) Intronic