ID: 1091394314

View in Genome Browser
Species Human (GRCh38)
Location 12:144191-144213
Sequence ATGGAGAAGCAGAAAGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 555
Summary {0: 1, 1: 0, 2: 5, 3: 48, 4: 501}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091394302_1091394314 30 Left 1091394302 12:144138-144160 CCTTGCTTCTCTCCGAGGTGGAG 0: 1
1: 0
2: 1
3: 13
4: 155
Right 1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG 0: 1
1: 0
2: 5
3: 48
4: 501
1091394310_1091394314 2 Left 1091394310 12:144166-144188 CCTGTCCTGCAAAGGGCAGGAGA 0: 1
1: 0
2: 2
3: 20
4: 217
Right 1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG 0: 1
1: 0
2: 5
3: 48
4: 501
1091394305_1091394314 18 Left 1091394305 12:144150-144172 CCGAGGTGGAGAGGGCCCTGTCC 0: 1
1: 0
2: 3
3: 31
4: 256
Right 1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG 0: 1
1: 0
2: 5
3: 48
4: 501
1091394311_1091394314 -3 Left 1091394311 12:144171-144193 CCTGCAAAGGGCAGGAGAAGATG 0: 1
1: 0
2: 5
3: 21
4: 250
Right 1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG 0: 1
1: 0
2: 5
3: 48
4: 501
1091394309_1091394314 3 Left 1091394309 12:144165-144187 CCCTGTCCTGCAAAGGGCAGGAG 0: 1
1: 0
2: 6
3: 65
4: 399
Right 1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG 0: 1
1: 0
2: 5
3: 48
4: 501

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091394314 Original CRISPR ATGGAGAAGCAGAAAGTGGC AGG Intronic
900177708 1:1298165-1298187 AAGGTGAAGCAGGAAGTGGGTGG - Intronic
900439369 1:2645705-2645727 ACAGAGAAGCAGGAAGGGGCAGG - Intronic
900482072 1:2904267-2904289 GTGGAGATGCAGACAGAGGCAGG + Intergenic
901228367 1:7628163-7628185 ATGGAGAAGGAGAAGGGAGCTGG - Intronic
901593359 1:10365419-10365441 ACGCAGCAGCAAAAAGTGGCGGG - Exonic
901897363 1:12325552-12325574 GTAGAGAAGTAGAAAGAGGCCGG - Intronic
902531343 1:17092650-17092672 ATAGAAAAGCATAAAGAGGCTGG + Intronic
902599912 1:17533945-17533967 AAGAAGAAGAAGAAAGTGGGTGG - Intergenic
903102031 1:21038507-21038529 ATGTAGAAGAAGAAACTGACAGG - Intronic
904576635 1:31509243-31509265 ATGGTGTAGCAGATGGTGGCAGG - Intergenic
905312785 1:37062026-37062048 ATGGACAAGCTGAAAGTTGATGG + Intergenic
905808212 1:40892348-40892370 AGGGAGAAACAGAAAGTGACAGG - Intergenic
907327968 1:53653171-53653193 AAGGAGAAAGAAAAAGTGGCTGG + Intronic
907871040 1:58443115-58443137 AAGGAGGAACAGGAAGTGGCAGG - Intronic
908043410 1:60141488-60141510 ATGGAAAAGCAGAAGGAAGCTGG + Intergenic
909085812 1:71169168-71169190 AAGGAGAAGCACACAGTGGCAGG + Intergenic
909529365 1:76664489-76664511 ATGGGGAAGCTGAATGTGGGTGG - Intergenic
909741802 1:79038096-79038118 CTGGAGAAGGAGAAAGAGACAGG - Intergenic
910336604 1:86139165-86139187 AGGGAGAAGGAGAAAGGGGGGGG + Intronic
910964228 1:92791938-92791960 ATGGAGAAGAAGAAAATGACTGG - Intronic
911818796 1:102389368-102389390 AAGGAGAAGTAGAAATTAGCAGG + Intergenic
912731693 1:112112621-112112643 TTGGAGAAGATGCAAGTGGCTGG - Intergenic
913196095 1:116457476-116457498 ATGAAGCAGCAGCAGGTGGCGGG - Intergenic
914262639 1:146011794-146011816 ATGAAAAAGCTGAAAGAGGCAGG - Intergenic
915953432 1:160205263-160205285 ATGGAGAGGCAGGAGGGGGCGGG - Intergenic
916005427 1:160655065-160655087 ATGGAGAAGAGGCAAGTGGATGG - Intergenic
916992815 1:170263095-170263117 GTTGAGAAGGAGAAAATGGCTGG - Intergenic
917922352 1:179760926-179760948 ATGGCGTAGAAGAGAGTGGCAGG - Intronic
918442715 1:184584073-184584095 AGGGGGAAGGAGAAAGTGGTGGG - Intronic
918628729 1:186689602-186689624 AAGGAGAAGAACAAAGTTGCAGG + Intergenic
919303409 1:195799359-195799381 AAGGAGAAGCACAAAGCAGCAGG - Intergenic
919804307 1:201371987-201372009 GTGGAGAGCCAGAAAGGGGCAGG - Intronic
921366319 1:214378077-214378099 CTAGAGAAGCAGAAGATGGCAGG - Exonic
922681705 1:227603631-227603653 ATGAAGCAGCAGAAGGGGGCTGG - Intronic
922970440 1:229731900-229731922 ATGGAGAAGCAGAATTTGGGAGG - Intergenic
923495584 1:234521719-234521741 ATGGAGAAGCAGCAAGGGGCAGG - Intergenic
924003928 1:239586038-239586060 ATGGAAGAGTAGAAAGTGGATGG - Intronic
1062764468 10:50138-50160 CTGGAGAAGGAGAAAATTGCTGG + Intergenic
1063275844 10:4567114-4567136 CTGGGGAAGCAAAAAATGGCTGG - Intergenic
1064265744 10:13823888-13823910 CTGGAAAAGTAGCAAGTGGCTGG - Intronic
1064577893 10:16764343-16764365 ATGGAGAGGAAGAGAGTGGAAGG - Intronic
1066485626 10:35840773-35840795 ATGGAGAAGAACAAAGTTGGAGG - Intergenic
1067012310 10:42726002-42726024 ATGGAGAGGAAGAGAGTGGAAGG + Intergenic
1067225760 10:44374745-44374767 ATGCAGAAAGAGAAAGTGGTTGG - Intronic
1067556612 10:47277601-47277623 AGGGAGAGGCAGGAGGTGGCAGG - Intergenic
1068285172 10:54924142-54924164 ATGGTGAAGCAGGAAGTGGGGGG + Intronic
1069053722 10:63821795-63821817 TGTGAGAAGCAGAAAGAGGCAGG - Intergenic
1069138195 10:64791454-64791476 CTGGAAAAGGAGAAAATGGCAGG + Intergenic
1070223985 10:74481512-74481534 ATGGTGAAACACAAACTGGCTGG - Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070653629 10:78255702-78255724 ATGGAAAAGCAGTAAGAGGCTGG - Intergenic
1071117316 10:82236674-82236696 ATGGAGAAGGAGATAGAGGGAGG - Intronic
1071384306 10:85104225-85104247 ATGGAGCAGCAGGGAGGGGCTGG - Intergenic
1072033470 10:91542823-91542845 TTTAAGAAGCAGAATGTGGCCGG + Intergenic
1072497457 10:95976248-95976270 ATGGGTGAGCAGAAAGTGGAGGG - Intronic
1074054470 10:109909885-109909907 TTGGGGATGCAGATAGTGGCAGG - Intronic
1074922023 10:118024434-118024456 ATGGATACGTAGAAGGTGGCGGG - Intronic
1075136115 10:119787757-119787779 ATCTAGAAGCAGACAGTAGCAGG + Intronic
1075443312 10:122496096-122496118 CTCGAGGAGCTGAAAGTGGCTGG + Intronic
1075455645 10:122583172-122583194 AGGGAGAAGAGGAAAGTGCCAGG + Intronic
1075457768 10:122595875-122595897 AGGGAGAAGAGGAAAGTGCCAGG + Intronic
1075848353 10:125565445-125565467 TTGGAGAAGGATAACGTGGCAGG + Intergenic
1076242642 10:128921411-128921433 GTGGACAACCAGAAAGTTGCAGG - Intergenic
1077174236 11:1181426-1181448 GTGGAGAAGGAGAAGGTGGTTGG - Intronic
1077210625 11:1369550-1369572 ATGGAGGACCAGAAGGAGGCAGG + Intergenic
1078019246 11:7641476-7641498 CAGGAGACACAGAAAGTGGCTGG + Exonic
1078413780 11:11148860-11148882 GGGGAGAAGCAGAATGAGGCAGG - Intergenic
1078414579 11:11155013-11155035 AAGGAGAAGCAGAGAGTGGTGGG + Intergenic
1078537341 11:12185592-12185614 ATGGATGAGCAGACTGTGGCTGG + Intronic
1079615358 11:22486108-22486130 AAGGAGAAGGAGAAAGTGCAAGG + Intergenic
1081092377 11:38888350-38888372 ATGGAGAGGCAAGAAGTGGCGGG - Intergenic
1083680203 11:64348287-64348309 TTGGAGCAGGAGAAGGTGGCTGG + Intronic
1084422622 11:69067913-69067935 TCTGAGAAGCTGAAAGTGGCTGG + Intronic
1084690477 11:70722416-70722438 CTGGAGGAGCAGAAAGGGACAGG - Intronic
1084899387 11:72298319-72298341 AGGGACAAGCAGCAAGTGCCAGG - Intronic
1085069519 11:73530493-73530515 GTGGTGAAGAAGAAACTGGCTGG - Intronic
1085224848 11:74910586-74910608 ATGGAGAAGCAGGCAGAGTCAGG + Intronic
1085892152 11:80593263-80593285 TTGGAGAAGCAAAAAGGGACAGG + Intergenic
1086207306 11:84274925-84274947 ATGGAGAAGAAGCATGTGGCTGG - Intronic
1087940724 11:104093753-104093775 AAGGAGAAGGAGAAGGTGGGTGG - Intronic
1088303750 11:108386615-108386637 ATGGAAAAGCACCAAGAGGCAGG + Intronic
1088398302 11:109393293-109393315 AGGGAGAAATGGAAAGTGGCTGG + Intergenic
1088743636 11:112786648-112786670 AAGGAAAAGCAGAGACTGGCTGG + Intergenic
1088827196 11:113506039-113506061 GTGGTGAAGCTGAAAGAGGCTGG - Intergenic
1089496663 11:118911495-118911517 ATGGAGAAGCTGGGGGTGGCGGG - Intronic
1090636271 11:128692383-128692405 ATTGAGAAGCAGACAGGAGCGGG + Intronic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1092084449 12:5744174-5744196 ATAGAGAAGAAGACGGTGGCAGG + Exonic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1092696296 12:11175446-11175468 ATGCAGAAGCATAAAGGGGTAGG + Intergenic
1092711603 12:11343667-11343689 ATAAAAAAGAAGAAAGTGGCTGG - Intergenic
1092749368 12:11704289-11704311 AAGGAGAAGAAGGAAGTGGAGGG + Intronic
1092846905 12:12592037-12592059 CAGGAGAAGTAGAAAGTGGCTGG - Intergenic
1093698953 12:22195953-22195975 ACATAGAAGCAGAAAGAGGCAGG + Exonic
1094061203 12:26316790-26316812 ATGAAAAAACAGAAATTGGCTGG + Intergenic
1094676727 12:32627863-32627885 ATGGTTAATGAGAAAGTGGCGGG + Intronic
1094870530 12:34596934-34596956 GTGGAGCAGCCCAAAGTGGCAGG + Intergenic
1095102664 12:38200743-38200765 CTGGAGAAGGAGAAAATTGCTGG - Intergenic
1095154971 12:38841857-38841879 AGGGAGAAGCAGAAAGATGAAGG + Intronic
1095210369 12:39487137-39487159 ATGTTGAACCAGAAAATGGCAGG - Intergenic
1095339359 12:41070106-41070128 ATGGAGCCGCAGAAATTGGAAGG - Exonic
1096405303 12:51339806-51339828 AGGGATAGGCAGAGAGTGGCGGG + Intronic
1096883788 12:54696673-54696695 ATGGTGAAGCAGAAAGAGAGTGG + Intergenic
1097176951 12:57148838-57148860 ATGGGGAAGAAGGAGGTGGCTGG + Intronic
1097596326 12:61636855-61636877 ATGGATAATCACAAAGAGGCAGG + Intergenic
1098126654 12:67302708-67302730 ATAGAGAAGCAGAAAGTTCTAGG + Intronic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1100015237 12:90002172-90002194 AAGGGAAAGCAGAAAGTTGCTGG + Intergenic
1100446563 12:94666001-94666023 ATGGAGAAGCAGGGAAAGGCTGG - Intergenic
1100642665 12:96497337-96497359 AAGGAGAAGAAGAAAGTTGGAGG + Intronic
1101523481 12:105506221-105506243 AAGGAGAGACAGACAGTGGCAGG + Intergenic
1103048460 12:117758853-117758875 AGGGAGAAGCACAAAGTGTGGGG + Intronic
1103290615 12:119843197-119843219 AGAGAGAAACAGTAAGTGGCTGG + Intronic
1103830637 12:123776218-123776240 AGGGAGAAGCAGACAGTGTGAGG + Intronic
1105439016 13:20400450-20400472 ATGGAGCAGGAGAGAGTGACAGG - Intergenic
1105985858 13:25566522-25566544 ATGGAAAAGGAGAAAGTGGCAGG + Intronic
1108695063 13:52895916-52895938 AAGGAGGAGCAGAAGCTGGCTGG - Intergenic
1108761396 13:53570165-53570187 ATGGATATGCAGAAAGGGGAAGG - Intergenic
1109142023 13:58725296-58725318 ATGGAGAAGGAGCTGGTGGCAGG + Intergenic
1109377922 13:61522833-61522855 ATGGAGAGCCAGAAGGTGGAGGG + Intergenic
1109932839 13:69238475-69238497 ATGGAGAAGCACAGAAGGGCAGG - Intergenic
1110675379 13:78236852-78236874 ATGAAACAGCAGAAAGTGGCTGG + Intergenic
1111400473 13:87727577-87727599 ATAGAGATGCGGAAAGTTGCAGG - Intergenic
1111739715 13:92188788-92188810 ATGCTGAACCAGAAAGTGGAAGG - Intronic
1112211204 13:97379623-97379645 ATGTACAAGCAGAAAGAGCCAGG + Intronic
1112554455 13:100453507-100453529 ATGGAGAAAAAGAAAGTGCAGGG + Intronic
1113024394 13:105924130-105924152 ATGGAGAAACAGACAGTTGGCGG - Intergenic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1113314028 13:109159774-109159796 CTGGAGAAGGAGAGAGAGGCTGG + Intronic
1114460358 14:22882694-22882716 GTGGAGAAGGAAAAGGTGGCAGG + Intergenic
1114479806 14:23025670-23025692 ACGGAGAAGGAGAGAGAGGCAGG - Intronic
1115129116 14:30032454-30032476 GTGGAGATGAAGAAAGTGGTTGG - Intronic
1115801276 14:36996691-36996713 ATGGAGAAAAAAAAAGTGGATGG + Intronic
1116675367 14:47899981-47900003 ATGGAGAAGCGGAAAAAGGCGGG + Intergenic
1117087533 14:52217046-52217068 AAAGAGAAGAAGAAAGTTGCAGG - Intergenic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117651459 14:57910720-57910742 AAGGAGAAGCACAAAGTTGGAGG - Intronic
1119644779 14:76340262-76340284 AACGAGGCGCAGAAAGTGGCTGG + Intronic
1119925383 14:78488764-78488786 ATGAAGAAGAAGAAAGGGGAGGG + Intronic
1120222139 14:81746724-81746746 AAGGAAAAGCAGAAAGGGGGTGG - Intergenic
1121564130 14:94895977-94895999 ATGGAGTTGCAGAGAGAGGCAGG + Intergenic
1121985046 14:98497178-98497200 AAGGAGAGGGAGAAAGTTGCCGG + Intergenic
1202933000 14_KI270725v1_random:56571-56593 ATTAAGAAGCAGAACTTGGCCGG + Intergenic
1124004560 15:25785579-25785601 AGGCAGAAGCAGTGAGTGGCAGG + Intronic
1125713238 15:41804134-41804156 AAAAATAAGCAGAAAGTGGCCGG - Intronic
1126040753 15:44588407-44588429 ATAGAGAAGAAGATAGTGACAGG + Intronic
1126796760 15:52265921-52265943 ATGGAAAGGCAGCAAGTGCCTGG - Intronic
1126923514 15:53555115-53555137 ATGGAGAAGCAAAGAATAGCAGG + Intronic
1127757339 15:62105346-62105368 AGGGAGAAGGAGCAGGTGGCAGG + Intergenic
1129651809 15:77496439-77496461 ATGGAAAAGGAGAAACTGGATGG - Intergenic
1130185730 15:81679541-81679563 ATGGAGAAACAGAAAAAAGCAGG + Intergenic
1130300706 15:82678180-82678202 TTGGAGAGGCAGAAAATGGGTGG + Intronic
1130353333 15:83109574-83109596 ATGGGGAAGCAGACAGTAGGAGG - Intronic
1130991232 15:88877268-88877290 ATGGAGACACAGAAAAGGGCTGG + Exonic
1131067221 15:89442226-89442248 CTGGAAAAGCAGAAAGGGGCGGG + Intergenic
1131573288 15:93561020-93561042 ATGGAAAAGGAAAAAGAGGCTGG + Intergenic
1132038218 15:98503856-98503878 ATGGGGGAGCAAAAAGGGGCAGG - Intronic
1132831886 16:1932468-1932490 AGGGAGAAGCAGAAAGGGACAGG + Intergenic
1133139179 16:3731771-3731793 ATGGAGAAGCACAAGGAGGTAGG - Exonic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133187904 16:4113863-4113885 ATGGAGCAGCTGGGAGTGGCCGG - Exonic
1135713249 16:24736525-24736547 AGAGAGAAGCAGAAAAGGGCAGG - Intronic
1135856425 16:26015333-26015355 ATGCAGAAGCAGAATCTGGTGGG + Intronic
1136051921 16:27657224-27657246 ATTGAGAAGGAAAAAGTGGGAGG + Intronic
1136096467 16:27960621-27960643 ATGGAGAAGCTGAGTGTGGTGGG + Intronic
1136500737 16:30668741-30668763 AGGGTGAAGCAGAGAGTGACAGG - Intronic
1136629777 16:31483137-31483159 ATGGAGGAGCACACAGAGGCAGG + Exonic
1137738685 16:50743091-50743113 ATTGAGGAGAAGAAGGTGGCAGG - Intronic
1137864589 16:51880102-51880124 TTGGGGAAGCAGAAAGTGTCTGG + Intergenic
1138036086 16:53608093-53608115 ACTGAGAAGTAGAGAGTGGCAGG - Intronic
1138195147 16:55046425-55046447 ATGGAGAAGCTGGAAGTCTCTGG - Intergenic
1138622690 16:58224458-58224480 AAGGTCATGCAGAAAGTGGCTGG + Intergenic
1138686310 16:58728981-58729003 ATTGAAAAGCAGAAAAGGGCCGG - Intronic
1138953628 16:61944246-61944268 GTTGAGAAGCACAAAGTGACAGG + Intronic
1140571808 16:76116270-76116292 ATGAAGAAGAACAAAGTTGCTGG - Intergenic
1141065856 16:80913068-80913090 TTGGAGAAGCAGGAAGAGCCAGG - Intergenic
1141957225 16:87380811-87380833 ATGGAGATGTAGAAAGCGACTGG - Intronic
1141991244 16:87611632-87611654 ATAGAGCAGCAGACAGAGGCGGG - Intronic
1142329201 16:89440130-89440152 CTGGAGAAGTAGGAAGAGGCAGG - Intronic
1142440183 16:90093107-90093129 CTGGAGAAGGAGAAAATTGCTGG - Intergenic
1143150157 17:4802555-4802577 ATGGAGAAGCAGGAGGTGGTTGG + Intergenic
1143537771 17:7551371-7551393 GTGGGGAAGCAGCAAGAGGCTGG - Intronic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144753184 17:17664119-17664141 ATGGAGAAGCATCAAGTATCAGG + Intergenic
1144772843 17:17769470-17769492 CTGGAGGAGCAGAAAGTAGTAGG + Intronic
1146111440 17:30093663-30093685 ATTGGAAAGCAGAAAGTGGTGGG - Intronic
1146430083 17:32784840-32784862 ATGGAGAACCGGAAGGTGGTTGG + Intronic
1146528160 17:33584647-33584669 ATGGATGATCAGAGAGTGGCAGG + Intronic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1146658853 17:34651428-34651450 CTGGAGGAGCAGAACGGGGCTGG + Intergenic
1146775377 17:35609783-35609805 ATGGAGAATTAGAATTTGGCTGG + Intronic
1146933602 17:36795649-36795671 ATGGATAAGCAAAATGTGGTAGG - Intergenic
1147260749 17:39208708-39208730 AGGGAGATGCAGAAAGAGGAGGG - Intergenic
1148217937 17:45844075-45844097 ATGGAGAGGAAGAAAGTGAAGGG - Intergenic
1148446235 17:47739287-47739309 ATGGAGACACAGGAAGAGGCTGG - Intronic
1148547351 17:48528501-48528523 ATGGAGAAACAGAAGCAGGCAGG + Intergenic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1148775920 17:50095697-50095719 ATGGGGAAGCAGGAACCGGCCGG + Intronic
1149161694 17:53701346-53701368 ATGGAGATGGAGCAAGTGGTAGG + Intergenic
1149586426 17:57790744-57790766 GTGGAGAAGAAGAAAGTGGGTGG - Intergenic
1149664320 17:58355087-58355109 AGGGAGAAGCAGAGACTGTCTGG + Intronic
1150122844 17:62617986-62618008 ATGTAAAATCAGAGAGTGGCTGG - Intergenic
1151466425 17:74288734-74288756 AAGGAGTTGCAGAAAGTGGGTGG + Intronic
1151732072 17:75917593-75917615 ATGTAGAGGCAGGAAGCGGCAGG + Intronic
1152957368 18:50454-50476 CTGGAGAAGGAGAAAATTGCTGG + Intronic
1153501895 18:5758123-5758145 ATCAGGAAGCAGTAAGTGGCAGG + Intergenic
1154489182 18:14906225-14906247 AGGGAGAGGCAGAGACTGGCAGG - Intergenic
1156513201 18:37659001-37659023 ATGGTGGACCAGACAGTGGCAGG - Intergenic
1157584642 18:48793247-48793269 AGGGAGAAGCAGGGAGGGGCAGG + Intronic
1159756059 18:72367594-72367616 AGAGAGAAGGAGAAAGTGGAAGG + Intergenic
1159990299 18:74899314-74899336 ATGGAAGGGCAGAGAGTGGCAGG + Intronic
1160093047 18:75845206-75845228 ATGGAGAGGAAGAAAGTGAGGGG - Intergenic
1160626377 18:80210238-80210260 ATGGATAAGCAGAGATTTGCAGG - Intronic
1160820986 19:1057940-1057962 ACGGAGAAGAAGAAGGAGGCTGG - Exonic
1161130086 19:2583169-2583191 ATGGACTAGCAGACAGTGGGTGG + Intronic
1162461328 19:10815913-10815935 AGGGAGAAGCAAAGAGAGGCGGG + Intronic
1162747533 19:12807058-12807080 CTGGAGGCGCTGAAAGTGGCAGG + Exonic
1163398165 19:17076047-17076069 ACGGTGAAGGAGAAAGTGGATGG + Intronic
1163708857 19:18833237-18833259 ATGGAGGAGCACATATTGGCTGG + Intronic
1164917171 19:32061111-32061133 TTGGAGAAGCAGAAACTAGGAGG - Intergenic
1165012585 19:32859622-32859644 AAGCAGAGGCAGAAAGTGCCAGG - Intronic
1165281983 19:34805570-34805592 CTGGAAATGGAGAAAGTGGCTGG - Intergenic
1165675037 19:37715200-37715222 TTTAAGAAACAGAAAGTGGCTGG - Intronic
1165856815 19:38883878-38883900 AGGGAGGAGAAGCAAGTGGCAGG + Intronic
1165913541 19:39244331-39244353 ATGGAGAAGGAGAAGGTGAAGGG + Intronic
1166088398 19:40492143-40492165 ATGGGGAAGCAACAAGGGGCAGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166388880 19:42397765-42397787 TTGGAGGAGCAGAAGGTGCCAGG + Intergenic
1167103638 19:47418728-47418750 ATAGAGAGGCAGAAAGAGGGGGG + Intronic
1167217470 19:48174073-48174095 ATGAGGCAGCAGAGAGTGGCAGG - Intronic
1168332832 19:55579733-55579755 ATGGAGAGGCAGAGAGGGTCAGG + Intronic
1168657670 19:58142826-58142848 AGGGAGAAGGAGAAAGGGGTTGG - Intronic
925618443 2:5766733-5766755 ATGTAGCAGCAGAAAGTCTCAGG - Intergenic
926305555 2:11635352-11635374 ATGAAGAAGCAGATCGTGGTGGG + Exonic
926312749 2:11686348-11686370 AGGGGGAACCAGAAAGTGGGTGG + Intronic
926490587 2:13521987-13522009 ATGCAGATGCATAAAGTGTCAGG + Intergenic
926725054 2:15991206-15991228 AAGAAGAAGAAGAAGGTGGCCGG - Intergenic
927263787 2:21121794-21121816 GTGGTAAAGCAGAAAATGGCAGG + Intergenic
927418865 2:22908468-22908490 ATGGAAAAGTAGAAAGGGCCTGG + Intergenic
927919912 2:26964264-26964286 ATGGAGATGCAGAAGCTGGGAGG + Intergenic
928075117 2:28257385-28257407 CTAGAGAAACAGAAAGTGGTCGG - Intronic
928508290 2:31977104-31977126 ATAGAGAAGCAGAAGACGGCAGG + Intronic
929350320 2:40943063-40943085 ATGGATAAGAAGAAAGTGGAAGG + Intergenic
929868258 2:45736581-45736603 ATGGAGAGGCAGGCAGTGTCAGG - Intronic
930551190 2:52836662-52836684 ATCCAGAAGCAGAAAGGAGCAGG + Intergenic
933197860 2:79412780-79412802 ATTGAGAAGGAGAAACTGGATGG + Intronic
933473131 2:82753017-82753039 ATGGAGAAGAGGGAAGTGGAGGG + Intergenic
933493009 2:83012342-83012364 AAGGAGAAGAAGAAAGTTGGAGG + Intergenic
934320592 2:91968008-91968030 GGGGAAAACCAGAAAGTGGCAGG - Intergenic
934737090 2:96695119-96695141 CTGAAGAAGCAGGAAGTGCCTGG - Intergenic
934777782 2:96950036-96950058 ATGGAGACGGGGAAAGAGGCAGG + Intronic
935037343 2:99391488-99391510 ATGGAGAATCAGAACGCTGCTGG + Intronic
935143607 2:100378026-100378048 AGGGAGAAACAGAAAGAGGTAGG - Intergenic
935562564 2:104574275-104574297 ATGGATAAGTAGAAAGTGCATGG + Intergenic
935633746 2:105233767-105233789 CTGGAGAAACACAAATTGGCAGG + Intergenic
935926071 2:108070288-108070310 AGGGAGCAGCAGAAAGGGACAGG - Intergenic
936345962 2:111675281-111675303 ATTGAGGAGCAGAAAGTTGTTGG + Intergenic
936596819 2:113856012-113856034 ATGAAGATTCAGAAAGTGGAAGG + Intergenic
938038920 2:128059608-128059630 AAGAAGAAGAAGAATGTGGCCGG + Intergenic
938083691 2:128384615-128384637 GTTGGGAAGCAGAGAGTGGCTGG - Intergenic
938168690 2:129056348-129056370 ATGGTGAATTAGAAAGAGGCTGG + Intergenic
939026118 2:137015462-137015484 CTGGAGCAGCAGAAAGCTGCTGG - Intronic
939503487 2:143014675-143014697 GTGGAGAAGAAGAAAGTTACGGG + Intronic
939519442 2:143211325-143211347 GTGGAGAAGTAAAAAATGGCGGG + Intronic
939619972 2:144406900-144406922 ATGGAGATGAAGGAAGTGTCTGG + Intronic
940974243 2:159925725-159925747 ATGGAGCACCAGAAAGGGTCAGG - Intergenic
942087590 2:172457889-172457911 ATGAAGAAGCAGAAAGCAGATGG + Intronic
942166303 2:173244118-173244140 CTGGAGACGCAGCAAGTGGGAGG + Intronic
942449416 2:176099862-176099884 TTGGAGAAGTAGAAAGAGTCTGG - Exonic
942991840 2:182211455-182211477 AAGGAGAAGCACAAAGTTGGAGG - Intronic
943743188 2:191433435-191433457 ATGTGGAAGCCGAAACTGGCAGG + Intergenic
945284241 2:208066132-208066154 AGGGAGAAGCAGAAAAAGCCAGG + Intergenic
946021916 2:216646213-216646235 ATGGAGAAGAGGACAGTGGAAGG + Intronic
946115496 2:217458427-217458449 AAGGAGAATAAGAAAGAGGCTGG - Intronic
946986867 2:225283121-225283143 TTGGAGAAACAGAAGGTGGTGGG - Intergenic
948104456 2:235401888-235401910 CTGGAGAAGGAGAAAGTTGTAGG - Intergenic
948417261 2:237819401-237819423 GTGGAGAACCAGGAAGTGGGAGG + Intronic
948464617 2:238146216-238146238 ATCGAGAAACAAAATGTGGCCGG + Intronic
1169044995 20:2528097-2528119 ATGGAGCAGAAGAAAGGGGCAGG + Intergenic
1170143400 20:13147561-13147583 ATAGAGAAGCAGGGAGGGGCAGG + Intronic
1170235433 20:14098981-14099003 ATAAAAAAGCAGAACGTGGCTGG + Intronic
1170589001 20:17757023-17757045 AGGGAGAAGCAGAAAGATACGGG - Intergenic
1170929730 20:20758162-20758184 ATGGGAAAGCAGAAAGGGACAGG + Intergenic
1170936122 20:20811250-20811272 ATGGAGAAGCAGCAAGAGTCTGG + Intergenic
1170962692 20:21039443-21039465 GTGGAGCATCAGCAAGTGGCTGG - Intergenic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1171155002 20:22863999-22864021 GTGAAGAAGCATAAACTGGCTGG + Intergenic
1171775454 20:29363223-29363245 CTGGAGAAGGAGAAAATTGCTGG + Intergenic
1172841483 20:37904855-37904877 ATGGTGAGGCAGAAGGGGGCGGG - Intronic
1173066067 20:39713275-39713297 ATGGCAAGGCAGAAAGAGGCAGG + Intergenic
1173579829 20:44139191-44139213 ATGGAGAACCACAGAGGGGCAGG + Intronic
1174153602 20:48502870-48502892 CTGGAGAACCAGAAAGGAGCTGG - Intergenic
1174718235 20:52783482-52783504 ACGGAGAATCAGAAAGTGGCAGG + Intergenic
1176084639 20:63290382-63290404 ATGGGGAAGACGAAAGTGGCGGG + Intergenic
1176529004 21:7943684-7943706 ATGGAGAGGAATAAAGTGGAAGG - Intergenic
1177163795 21:17577822-17577844 TAGGAGAAGCAGAGAGTGCCAGG - Intronic
1178122781 21:29485865-29485887 GTGGAGAAGAAGAAAGGTGCAGG - Intronic
1178600686 21:33991987-33992009 AGGGAGAAGCAGAAAGGTGCAGG + Intergenic
1180119925 21:45739397-45739419 ATGGACAAACAGGAAGTGGTGGG - Intronic
1180119943 21:45739452-45739474 ATGGACAAACAGGAAGTGGTGGG - Intronic
1180197897 21:46208393-46208415 CTGGAGAGGCAGAACGTGCCTGG + Intronic
1180334242 22:11561056-11561078 CTGGAGAAGGAGAAAATCGCTGG - Intergenic
1181316571 22:21974495-21974517 ATGAGGAAGCACAAAGTGACTGG + Intronic
1182136065 22:27904252-27904274 ATGGATAAACAAAATGTGGCAGG + Intronic
1182672084 22:32004886-32004908 ATTGAGAAGCAGACACTGGCTGG - Intergenic
1182841973 22:33398410-33398432 ATAGAGAAGCAGAGAGTTGGAGG - Intronic
1182890863 22:33817887-33817909 ATGGAGAAGCTGAAGGAGGGAGG + Intronic
1182990068 22:34759182-34759204 ATGGATAGGAAGAAAGTGGAAGG + Intergenic
1183671587 22:39276053-39276075 AGGTAGAAGCAGCAGGTGGCCGG + Intergenic
1184149228 22:42628845-42628867 ATGGAGAAGGGGAAGGTGGCTGG + Intronic
1184892670 22:47389410-47389432 AGGCAGGAGCAGAACGTGGCTGG - Intergenic
1184950670 22:47840529-47840551 CTGGGGAGGCAGAAAGGGGCAGG - Intergenic
1185263637 22:49885745-49885767 CTGGAGAAGTAGGAAGGGGCGGG - Exonic
1185411453 22:50685106-50685128 ATGGGAAAGCAGAATGGGGCTGG + Intergenic
949360914 3:3231291-3231313 AAGGTGAAGCAGAAGCTGGCAGG + Intergenic
949483984 3:4519892-4519914 AAGGAGAGGCAGAGAGTGTCTGG + Intronic
949579728 3:5375940-5375962 CTGGAGTATCAGAAAGTGACAGG - Intergenic
949866050 3:8548595-8548617 AAGGAGAAGCAGCCAGTGACAGG + Exonic
949915588 3:8961333-8961355 AGGGAGAAGTAGAAAATGGGTGG + Intronic
950768349 3:15290914-15290936 AGGCAGAAACAGGAAGTGGCTGG + Intronic
950850280 3:16055640-16055662 AAAGAGAAGCAGAAAGTGAAAGG - Intergenic
951448351 3:22808204-22808226 AAGGACAAGAAGAGAGTGGCTGG + Intergenic
954392775 3:50276109-50276131 AGGGAGAATCCGAAAGAGGCGGG - Intronic
955663582 3:61327186-61327208 GTGGAGAAGCAGAAAGCTGGTGG + Intergenic
956321416 3:68000777-68000799 ATGGAGAGGGAGAAAGTGGATGG + Intergenic
956553012 3:70482958-70482980 CTGGAGAATGAGAAAGGGGCTGG + Intergenic
957223513 3:77413829-77413851 ATGGACAAGTAAAATGTGGCAGG + Intronic
957632858 3:82740560-82740582 ATGGAGAAGCAGAGAGGAGAGGG + Intergenic
959423060 3:106151425-106151447 ATGGTGTAGCTGAAAGTGACGGG - Intergenic
959502066 3:107118179-107118201 ATGGGGAAGCAGCAGTTGGCAGG - Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960024910 3:112998065-112998087 AGTGAGAAGCAGAAAGTGTGTGG - Intronic
960431879 3:117579553-117579575 AAGGAGAAGAAGAAAGAGGTCGG + Intergenic
960547539 3:118933811-118933833 ATTGAGAAGCAGGAAGTAGAAGG - Intronic
961722912 3:128908085-128908107 ATGGGCAAGCAGGCAGTGGCCGG + Intronic
962149419 3:132877205-132877227 TTGATGAAGCAGAAAGTGGGAGG - Intergenic
962369443 3:134808662-134808684 ATGGGGAAACAGAAAGTGATGGG + Intronic
964248030 3:154676965-154676987 ATGGAGAAGTAGAAAGGAGCTGG - Intergenic
966241636 3:177760796-177760818 TTGGAGAAGGAAAAAGTGGTTGG + Intergenic
966816981 3:183897330-183897352 ATGGAGCAGCAGATGCTGGCTGG + Intergenic
966895108 3:184439084-184439106 AAGGAGAAGGAGAAAGGGGGAGG + Intronic
967067849 3:185937018-185937040 ATTGTGAAGGAGAAATTGGCGGG - Intronic
967200383 3:187067538-187067560 GAAGAGAAACAGAAAGTGGCTGG - Intronic
968525062 4:1052514-1052536 ATGGAGCAGCAGAGACTGGCAGG - Intergenic
968602262 4:1515782-1515804 ATGGAGAAGCCCATAGAGGCAGG - Intergenic
970004594 4:11398462-11398484 ATGGAGAAGCAGTTAGTGACTGG - Exonic
970916184 4:21338002-21338024 ATGGTGGAGCAGAAAGTGGAAGG - Intronic
971090622 4:23340535-23340557 AAGGAGAAGAAGAAAGTTGGAGG + Intergenic
971542844 4:27842825-27842847 ATGGAGAAACATAATGTGGAGGG + Intergenic
972025892 4:34376939-34376961 AAGGAGAAGCAGAAAGTGTGAGG + Intergenic
972246986 4:37255648-37255670 ATAGGGTAGCAGAAAGTGTCTGG + Intronic
972726288 4:41748658-41748680 ATGGATATGGAGAAGGTGGCTGG + Exonic
972830034 4:42803791-42803813 CTGGAGCAGGAGAAAGTGGGGGG + Intergenic
972926925 4:44020585-44020607 ATAGAAAAGCAAATAGTGGCTGG - Intergenic
974389207 4:61243435-61243457 AGGGAGAAGCAGAGATTGGGTGG - Intronic
975077297 4:70226992-70227014 ATTTAGAAGAAGAAAGAGGCAGG - Intronic
975214768 4:71740513-71740535 ATGTAGAAGCTGCAAGCGGCAGG + Intergenic
976144950 4:82033070-82033092 TTGCAGAAACAGATAGTGGCTGG - Intronic
976550789 4:86392778-86392800 AGGGATAAGGAGGAAGTGGCTGG + Intronic
976793916 4:88911294-88911316 ACGGAGCAGCTCAAAGTGGCTGG + Intronic
976954025 4:90871985-90872007 AATGAAAAGCAGAAAATGGCAGG - Intronic
977126116 4:93170538-93170560 ATGGCGAAGCAGGAACTGTCTGG - Intronic
978430358 4:108626813-108626835 ATGCAGAAGCTGAAAGTACCTGG + Intronic
978685362 4:111435840-111435862 TTGGAGAAGAGGAATGTGGCTGG - Intergenic
979973699 4:127169434-127169456 ATGGAGAAGAAGGTATTGGCTGG - Intergenic
980128943 4:128800729-128800751 ATGAAGAGGCACAAAGTGGGAGG + Intergenic
980632821 4:135458612-135458634 ATAGAAATGCAGAAAGAGGCTGG - Intergenic
980882329 4:138724558-138724580 ATAGAGAAGGGGAAAGAGGCAGG - Intergenic
981120131 4:141040025-141040047 ATGGAGAAGGAAAAAGGAGCGGG - Intronic
981400056 4:144303352-144303374 ATGGATAAGCAGCAATTGGCTGG - Intergenic
982640835 4:157958087-157958109 ATGCAGAAAGAGAAAGTGGGAGG - Intergenic
983356680 4:166669366-166669388 GATGAGAAGCAGAAAGTGACTGG + Intergenic
983365004 4:166775219-166775241 GTGGATGAGGAGAAAGTGGCAGG + Intronic
984004307 4:174290148-174290170 ATTAAGAAGAAGAAAGAGGCAGG - Intronic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
984632615 4:182076496-182076518 ATAAAGAAGGAGAAAGAGGCTGG - Intergenic
984732385 4:183079832-183079854 ATGGAGAAGCAGCAGGAGCCAGG + Intergenic
984792484 4:183627359-183627381 ATGGAGAGTCAGATAGTAGCAGG - Intergenic
986422771 5:7600793-7600815 ATAGATTAGCAGAAAATGGCAGG + Intronic
986560690 5:9058014-9058036 GTGGGGAAGTAGAAAGTTGCAGG + Intronic
987029516 5:13963035-13963057 AGGGAGAGGGAGAAGGTGGCTGG - Intergenic
987081798 5:14431850-14431872 ATGGAGAATCAGCAAGAGGGTGG - Intronic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
989238896 5:39180760-39180782 CTGGAGAAGTAGAAAGTAGATGG - Intronic
989272589 5:39550485-39550507 AGGGAGTAGCAGAAAGTGTCAGG + Intergenic
989654620 5:43733135-43733157 AAGGAGAAGGAAAAAGTGGTGGG - Intergenic
990262286 5:54036416-54036438 ATGTAGAAGTAGAAATTGGATGG - Intronic
990817800 5:59805087-59805109 ATTAAGAAACAGAATGTGGCAGG - Intronic
992969951 5:82046169-82046191 TTGGAGAAGCAGGAAGAGGTAGG - Intronic
993069413 5:83140747-83140769 ATTGAGAAACAGAAAGGGGTGGG - Intronic
993071198 5:83166181-83166203 ATGGATAAGAAAAATGTGGCCGG - Intronic
993521187 5:88903915-88903937 CTGGAGAAGCAGAAAGGCACTGG - Exonic
994145624 5:96391877-96391899 AATCAGAAGCAGAAACTGGCAGG - Exonic
994162071 5:96567938-96567960 ATGGAGGAGGAGAGGGTGGCAGG + Intronic
995037082 5:107546337-107546359 ATCCATAAGCAGAAAGAGGCTGG + Intronic
995322601 5:110853747-110853769 ATGGAGAAGAAGAAGGAGACAGG + Intergenic
996075238 5:119185183-119185205 GTAGAGGAGCAGAAAGTGACAGG - Intronic
996337485 5:122400633-122400655 ATGGAGAAGCAGAACACAGCTGG + Intronic
996804821 5:127442746-127442768 ATGTAGCAGCTGAAAGTGTCAGG + Intronic
997559672 5:134835351-134835373 ATTGAAAAGCAGGAAGAGGCCGG + Intronic
997783387 5:136682909-136682931 TTTGAGAAGCAGCCAGTGGCAGG + Intergenic
999148774 5:149413021-149413043 AGGGTGAAGGAGAAAGAGGCTGG + Intergenic
999320807 5:150613952-150613974 ATGGGGAATCAGAAGGAGGCTGG + Intronic
999376614 5:151091170-151091192 AAGAAGAAGCAGAAAGGAGCTGG - Intronic
999440278 5:151595472-151595494 AAGGAGGAGCAGAAGGTGGAAGG + Intergenic
1000092671 5:157943555-157943577 ATGGCCAAGCAGGAACTGGCAGG - Intergenic
1001088828 5:168722001-168722023 ATAAAGAAGCAGAAAGTTGAAGG + Intronic
1001240619 5:170067267-170067289 AGGCAGAAGCAGGAAGTGTCAGG - Intronic
1002494144 5:179600299-179600321 ATGGAGACCCAGAAAGTAACTGG - Intronic
1002612927 5:180433213-180433235 AGAGTGAAGCAGGAAGTGGCAGG - Intergenic
1003138625 6:3453811-3453833 AAGTAGAAGCAGAAAGTGGAAGG - Intronic
1003700546 6:8459951-8459973 ATCAAGAAGTAGAAAGAGGCTGG - Intergenic
1003822762 6:9918284-9918306 ATGGAGGAGCAGCATGTGGTGGG - Intronic
1004272814 6:14210815-14210837 ATGGATAAGCAACAAGTGGCTGG + Intergenic
1004629499 6:17407845-17407867 ATGAAGAAGCAAAAGGGGGCTGG + Intronic
1005033140 6:21530063-21530085 ATGAACAAGCCCAAAGTGGCTGG - Intergenic
1006278707 6:33029016-33029038 ATGGAGAAGGAGAGAGGGGGAGG - Intergenic
1007143362 6:39600621-39600643 ATAGAGAAGGAGAAAGTGACTGG - Intronic
1007189569 6:40001982-40002004 ATGGATAAACTTAAAGTGGCTGG + Intergenic
1008666158 6:53718577-53718599 ATGGTGAGGCAGAGAATGGCAGG + Intergenic
1009590935 6:65670088-65670110 AAGGAGAAACAGAAAGGTGCAGG - Intronic
1009836638 6:69009539-69009561 TTGGAGAGACAGGAAGTGGCTGG + Intronic
1012305101 6:97645939-97645961 AAGGTGAAGGAGAAAGTGTCAGG + Intergenic
1013862457 6:114652218-114652240 AGGGAGAAGCAGAATTGGGCAGG - Intergenic
1013956838 6:115852183-115852205 ATGGAGAAGCACAAAAAGTCAGG + Intergenic
1014778127 6:125533788-125533810 TTGGGGAGGCAGAAAGGGGCAGG + Intergenic
1015254400 6:131162015-131162037 AGGGAGAAGCAGAAAATGAGCGG - Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1016031004 6:139338108-139338130 ATGGAGAAGAACAAAAAGGCAGG + Intergenic
1016076468 6:139802442-139802464 ATGGAGCTGCAAATAGTGGCAGG + Intergenic
1016429782 6:143970985-143971007 AGGGAGAGGCAGAGAGTGGAGGG - Intronic
1016811258 6:148263217-148263239 CCGAAGAAGCAGAAGGTGGCAGG + Intergenic
1016820107 6:148339155-148339177 ATTGATAAGTAGAAAGTAGCTGG + Intronic
1017056799 6:150443863-150443885 ATGGTGCAGCAGAAAGAGGCTGG + Intergenic
1018279813 6:162173035-162173057 ATGGGGAAGGAGAAACTGGGGGG + Intronic
1018477437 6:164157642-164157664 ATGGAGAAGGAAAACGAGGCTGG + Intergenic
1019803518 7:3105704-3105726 AAAGAGAAACAAAAAGTGGCTGG - Intergenic
1020472359 7:8553409-8553431 ATGATGGAGCAGAAATTGGCTGG + Intronic
1021862228 7:24917207-24917229 ATGGAGAACAAGGAAGAGGCAGG - Intronic
1021930272 7:25574067-25574089 ATGGAGAAGCTGAAAATTGTGGG + Intergenic
1022220902 7:28312479-28312501 ATGGACATGCAGAAAGTCTCTGG + Intronic
1022376128 7:29813121-29813143 ATGGGGAAGAAGAAAGAGCCTGG - Intronic
1022563404 7:31373180-31373202 ATGGAGCATCAGCAAGGGGCAGG - Intergenic
1023153995 7:37229476-37229498 ATAGAGAAGGAGACAGAGGCTGG + Intronic
1026094767 7:67336091-67336113 CTGGAGAAGCAGAAAGGCACTGG + Intergenic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1027132246 7:75599325-75599347 CTGGAGGAGGAGAAAGGGGCGGG - Intronic
1027609709 7:80345459-80345481 ATGGAGACTCAGAAGGTGGAGGG + Intergenic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1027939775 7:84661752-84661774 ATCAAGAGGCAGAAAATGGCAGG + Intergenic
1029218416 7:98969272-98969294 ATGGGGATGCAGAGAGAGGCAGG - Intronic
1029520253 7:101056309-101056331 AAGGAGAAGAAGAAAGTCGCAGG - Intronic
1030359138 7:108577152-108577174 ATCAAGAAGTAGAAAGCGGCTGG + Intergenic
1030769774 7:113459819-113459841 ATGGAGAAGTAGGAAGTAGTGGG - Intergenic
1030814792 7:114022853-114022875 ATAGAAAAGCAGAAAGTCGCAGG - Intronic
1031101737 7:117489309-117489331 ATGCTGAAGAAGAAAGTGGTAGG + Intronic
1031395597 7:121269997-121270019 AGGGAGAAGGAGAGAGAGGCGGG + Intronic
1031496449 7:122454880-122454902 AGGGATAAGCAGATAGTGGCTGG - Intronic
1032605491 7:133346319-133346341 ATGGAGAAGCAGACAGAAGCAGG - Intronic
1033431137 7:141290730-141290752 AAGGAGAGGCCGAAAGGGGCAGG - Intronic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1034821456 7:154220248-154220270 ATGGAAGAGCAGAAAGGGCCAGG - Intronic
1036121054 8:6018221-6018243 ATTCAGATGAAGAAAGTGGCAGG + Intergenic
1036569988 8:9971750-9971772 ATGGATAAACAGAATGTGGTAGG - Intergenic
1037409478 8:18581004-18581026 AGAGAGAAGCAGAGACTGGCAGG + Intronic
1037584767 8:20268828-20268850 ATGGAAAGGCAGAAAGTGAAAGG + Intronic
1037747116 8:21654565-21654587 AAGGAGAAACAGAGACTGGCTGG - Intergenic
1037930580 8:22877843-22877865 AGGGAGAGGCAGAAAGCTGCAGG + Intronic
1039030149 8:33299803-33299825 AGGGAGAATCAGGAAGTGGTTGG - Intergenic
1039485217 8:37904542-37904564 ATGGAGGAGCAGAAAGGGGCTGG + Intergenic
1039585238 8:38701753-38701775 GTGGAGCAGCAGGAAGTGGACGG + Intergenic
1041487483 8:58394963-58394985 ATGGAGAAGCAAAAAGTCAGAGG + Intergenic
1042938622 8:74085575-74085597 TTGGAAAAGCAGAAAGGAGCTGG - Intergenic
1043461621 8:80466207-80466229 ATGGAGAAAAAGTAAGTGGTGGG - Intergenic
1043508445 8:80925661-80925683 GGGGGGAAGGAGAAAGTGGCTGG - Intergenic
1043796672 8:84550234-84550256 AAGGAAAAGGAGAAAGTGGAGGG - Intronic
1043821831 8:84875961-84875983 ATGGAGAATCTGAAAGTGTGGGG + Intronic
1044636610 8:94331607-94331629 ATGGACAAGCAGAGAGCAGCAGG - Intergenic
1044692106 8:94891361-94891383 ATGAAAAACCACAAAGTGGCCGG + Intronic
1044725104 8:95188300-95188322 GTGGAGAAGCAGAAGGCAGCAGG + Intergenic
1045058322 8:98389191-98389213 ATGGAGAAGGTGAAACAGGCTGG - Intergenic
1047027010 8:120835254-120835276 ATGGAGAGGCAGAACGTGACAGG - Intergenic
1047345132 8:124020424-124020446 AAGATGAAGCAGACAGTGGCAGG + Intronic
1047402330 8:124557504-124557526 GGGGAGAAGCAGAAAGCAGCCGG - Intronic
1047983814 8:130212113-130212135 AAAGGGAAGCAGAAAGTTGCTGG + Intronic
1048118609 8:131553802-131553824 ATGAAGAAGAAGGCAGTGGCTGG + Intergenic
1048179207 8:132179995-132180017 GAGGAGAAACAGGAAGTGGCGGG - Intronic
1048324480 8:133428576-133428598 AGAGAGAAGCATAGAGTGGCTGG - Intergenic
1048781180 8:138003677-138003699 GTGGAGCAGCAGAAAGTGGAAGG - Intergenic
1048829605 8:138463470-138463492 ATGGTGAAGCAGGAAGAGCCTGG + Intronic
1048948334 8:139471552-139471574 ATGGAGTAGAAGAAAGGGGGAGG + Intergenic
1048963814 8:139600700-139600722 AAGGAGCAGCAAAAAGGGGCAGG + Intergenic
1049623766 8:143611093-143611115 ACGGAGAAGCTGAACGGGGCTGG - Intergenic
1049802637 8:144525277-144525299 GTGGAGAAGGAGAAGGTGACAGG - Intronic
1050002842 9:1096905-1096927 ATGGAAAAGTAGACAGTGACAGG + Intergenic
1051005699 9:12340748-12340770 ATGGGGAAGTAGAAATAGGCTGG - Intergenic
1052179500 9:25506671-25506693 ATGGAGAAGAAGAAAGAGAAAGG + Intergenic
1053124904 9:35573014-35573036 ATGGAGAGACAGAAAGGGGGAGG + Intergenic
1053560288 9:39185647-39185669 GTGGCCAAGCAGAAAGTGACAGG + Intronic
1053824392 9:42005890-42005912 GTGGCCAAGCAGAAAGTGACAGG + Intronic
1054136830 9:61433308-61433330 GTGGCCAAGCAGAAAGTGACAGG - Intergenic
1054606179 9:67181473-67181495 GTGGCCAAGCAGAAAGTGACAGG - Intergenic
1055433906 9:76272881-76272903 TTGGAGAAGCAAGAAGAGGCAGG - Intronic
1056121988 9:83497688-83497710 AAAGAGAAGCAGAGAGTGGAAGG - Intronic
1056344165 9:85673641-85673663 TTGGAGATACAAAAAGTGGCAGG + Intronic
1056512828 9:87321869-87321891 ATGGAGTAGGAGGAAGGGGCTGG - Intergenic
1057414121 9:94846225-94846247 CTGGAGAAGCACAACGTGGAAGG + Intronic
1057779137 9:98035563-98035585 TTGGGGAAGCAGAAAGTAGGTGG + Intergenic
1058973347 9:110102887-110102909 CTGCAGAGGCAGAAAGAGGCTGG - Intronic
1059281485 9:113137881-113137903 ATGGTGAAGCAGTCAGAGGCAGG + Intergenic
1059323853 9:113490316-113490338 CTGGAGAAGGGGAAAGTGGATGG - Intronic
1059520770 9:114939788-114939810 TTGGAGTAGAAGAAAGTGGAAGG - Intergenic
1060146134 9:121253929-121253951 AAGGAGAAGAAGAAAGTGAAGGG - Intronic
1061329520 9:129883730-129883752 ATCAAGGAGCAGAAAGTTGCTGG - Intergenic
1062740778 9:138174119-138174141 CTGGAGAAGGAGAAAATTGCTGG - Intergenic
1203491355 Un_GL000224v1:108419-108441 CTGGAGCAGGAGAAAGTGGGTGG + Intergenic
1203503979 Un_KI270741v1:50289-50311 CTGGAGCAGGAGAAAGTGGGTGG + Intergenic
1185638963 X:1575827-1575849 ATGGGTAAGTAGAAAGTGGGTGG + Intergenic
1185841047 X:3391523-3391545 ATGGAGAGGCAGAAAGTGACAGG + Intergenic
1186055530 X:5645652-5645674 ATGGAGGAGAAGTTAGTGGCTGG + Intergenic
1186311067 X:8319684-8319706 ATGGAGAAGAATAAACAGGCTGG - Intergenic
1186459946 X:9740034-9740056 CAGGAGAAGGAGAAAGTGGGAGG + Intronic
1186821352 X:13291188-13291210 ACGCAGGCGCAGAAAGTGGCGGG - Intergenic
1186821366 X:13291249-13291271 ACGCAGGCGCAGAAAGTGGCGGG - Intergenic
1187069781 X:15877145-15877167 ATGGAGAAGTTGGAAGGGGCAGG + Intergenic
1187102249 X:16205674-16205696 ATGGAGTAGTAGACAGTGACTGG - Intergenic
1187715000 X:22093897-22093919 ATGGAAGAGCAGAAAATAGCAGG - Intronic
1187973275 X:24679949-24679971 ATGGAGAAGAGGAAAGGGGAAGG - Intergenic
1188158741 X:26774966-26774988 ATGGAGACTCAGAAAGGGGAAGG + Intergenic
1189163940 X:38840289-38840311 ATGGACAAGCATAAAGAGGTGGG + Intergenic
1189493507 X:41488673-41488695 ATGGAGAAGAATAAAGTGAGAGG + Intergenic
1189501169 X:41560558-41560580 ATTAATAAGCAAAAAGTGGCTGG - Intronic
1190443755 X:50502340-50502362 ATCAATAAGGAGAAAGTGGCTGG + Intergenic
1190827011 X:54026898-54026920 GTGTAGAAGTAGGAAGTGGCTGG - Intronic
1191113423 X:56826804-56826826 ATGGAGAAGAAGAAATTCACAGG - Intergenic
1192215943 X:69158235-69158257 CTGGAGAATCAGAAACTGGCAGG + Intergenic
1194349877 X:92813039-92813061 ATGGAGGGTCATAAAGTGGCTGG + Intergenic
1194739324 X:97553687-97553709 AAGAAGAAGAAGAAAATGGCTGG + Intronic
1194954179 X:100160407-100160429 ATGGGAAAGCAGAAAAGGGCAGG - Intergenic
1195345720 X:103949201-103949223 ATGGAGAACCAGAAAATGTCAGG + Intronic
1195861743 X:109390274-109390296 ATTGGGATGCAGATAGTGGCAGG + Intronic
1196050096 X:111295865-111295887 ATGGAGAAGAAGAAAGGGCCAGG + Exonic
1196335846 X:114532918-114532940 ATGGAGAATCAAAATGTGTCAGG + Intergenic
1196462843 X:115947576-115947598 TGGGAGCAGCAGAAATTGGCAGG - Intergenic
1198741130 X:139844311-139844333 AAGGAGTAGCAGAGAGTGGAGGG + Intronic
1199482309 X:148311180-148311202 ATGGGAAAGCAGAAAGCCGCAGG + Intergenic
1200118686 X:153780566-153780588 TAGAAGAAGCAGGAAGTGGCTGG + Intronic
1200658197 Y:5929667-5929689 ATGGAGGGTCATAAAGTGGCTGG + Intergenic
1201069260 Y:10129498-10129520 CTGGAGAAGGAGAAAATTGCTGG - Intergenic
1201474283 Y:14364080-14364102 AAGGAGGAGAAGAAAGGGGCAGG + Intergenic
1201693890 Y:16802024-16802046 ATGGATAAGCAGAGAGTAGATGG + Intergenic
1201726122 Y:17153946-17153968 ATGGAGATGCAGAGAGTAGATGG + Intergenic
1201759311 Y:17519902-17519924 CTGGAGAAGGAGAAAATTGCTGG + Intergenic
1201842243 Y:18386088-18386110 CTGGAGAAGGAGAAAATTGCTGG - Intergenic