ID: 1091397158

View in Genome Browser
Species Human (GRCh38)
Location 12:161004-161026
Sequence GCTGAAAGAAATCAGGCGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 201}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091397158_1091397163 -4 Left 1091397158 12:161004-161026 CCCGCCGCCTGATTTCTTTCAGC 0: 1
1: 0
2: 1
3: 22
4: 201
Right 1091397163 12:161023-161045 CAGCCTCCTTGGCTGCTGCATGG 0: 1
1: 0
2: 12
3: 150
4: 497

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091397158 Original CRISPR GCTGAAAGAAATCAGGCGGC GGG (reversed) Intronic