ID: 1091397163

View in Genome Browser
Species Human (GRCh38)
Location 12:161023-161045
Sequence CAGCCTCCTTGGCTGCTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 660
Summary {0: 1, 1: 0, 2: 12, 3: 150, 4: 497}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091397154_1091397163 30 Left 1091397154 12:160970-160992 CCATACACTCAGCCTTTCTCCTT 0: 1
1: 0
2: 10
3: 83
4: 620
Right 1091397163 12:161023-161045 CAGCCTCCTTGGCTGCTGCATGG 0: 1
1: 0
2: 12
3: 150
4: 497
1091397158_1091397163 -4 Left 1091397158 12:161004-161026 CCCGCCGCCTGATTTCTTTCAGC 0: 1
1: 0
2: 1
3: 22
4: 201
Right 1091397163 12:161023-161045 CAGCCTCCTTGGCTGCTGCATGG 0: 1
1: 0
2: 12
3: 150
4: 497
1091397160_1091397163 -8 Left 1091397160 12:161008-161030 CCGCCTGATTTCTTTCAGCCTCC 0: 1
1: 1
2: 4
3: 35
4: 339
Right 1091397163 12:161023-161045 CAGCCTCCTTGGCTGCTGCATGG 0: 1
1: 0
2: 12
3: 150
4: 497
1091397156_1091397163 18 Left 1091397156 12:160982-161004 CCTTTCTCCTTGGTTTTTCTCAC 0: 1
1: 0
2: 4
3: 37
4: 541
Right 1091397163 12:161023-161045 CAGCCTCCTTGGCTGCTGCATGG 0: 1
1: 0
2: 12
3: 150
4: 497
1091397157_1091397163 11 Left 1091397157 12:160989-161011 CCTTGGTTTTTCTCACCCGCCGC 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1091397163 12:161023-161045 CAGCCTCCTTGGCTGCTGCATGG 0: 1
1: 0
2: 12
3: 150
4: 497
1091397159_1091397163 -5 Left 1091397159 12:161005-161027 CCGCCGCCTGATTTCTTTCAGCC 0: 1
1: 0
2: 1
3: 17
4: 157
Right 1091397163 12:161023-161045 CAGCCTCCTTGGCTGCTGCATGG 0: 1
1: 0
2: 12
3: 150
4: 497

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091397163 Original CRISPR CAGCCTCCTTGGCTGCTGCA TGG Intronic