ID: 1091397655

View in Genome Browser
Species Human (GRCh38)
Location 12:163513-163535
Sequence GCCGCCTGGTGTGCTGCAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 1, 2: 0, 3: 23, 4: 211}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091397648_1091397655 6 Left 1091397648 12:163484-163506 CCGCGTGCAGGTGCTGTCCGTGC 0: 1
1: 0
2: 0
3: 13
4: 85
Right 1091397655 12:163513-163535 GCCGCCTGGTGTGCTGCAGCCGG 0: 1
1: 1
2: 0
3: 23
4: 211
1091397645_1091397655 12 Left 1091397645 12:163478-163500 CCCTGCCCGCGTGCAGGTGCTGT 0: 1
1: 0
2: 0
3: 7
4: 113
Right 1091397655 12:163513-163535 GCCGCCTGGTGTGCTGCAGCCGG 0: 1
1: 1
2: 0
3: 23
4: 211
1091397642_1091397655 23 Left 1091397642 12:163467-163489 CCCGCTGAGCGCCCTGCCCGCGT 0: 1
1: 0
2: 0
3: 12
4: 131
Right 1091397655 12:163513-163535 GCCGCCTGGTGTGCTGCAGCCGG 0: 1
1: 1
2: 0
3: 23
4: 211
1091397646_1091397655 11 Left 1091397646 12:163479-163501 CCTGCCCGCGTGCAGGTGCTGTC 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1091397655 12:163513-163535 GCCGCCTGGTGTGCTGCAGCCGG 0: 1
1: 1
2: 0
3: 23
4: 211
1091397643_1091397655 22 Left 1091397643 12:163468-163490 CCGCTGAGCGCCCTGCCCGCGTG 0: 1
1: 0
2: 0
3: 11
4: 136
Right 1091397655 12:163513-163535 GCCGCCTGGTGTGCTGCAGCCGG 0: 1
1: 1
2: 0
3: 23
4: 211
1091397647_1091397655 7 Left 1091397647 12:163483-163505 CCCGCGTGCAGGTGCTGTCCGTG 0: 1
1: 0
2: 0
3: 14
4: 101
Right 1091397655 12:163513-163535 GCCGCCTGGTGTGCTGCAGCCGG 0: 1
1: 1
2: 0
3: 23
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091397655 Original CRISPR GCCGCCTGGTGTGCTGCAGC CGG Exonic
900002197 1:20898-20920 TCCTCCTGCTCTGCTGCAGCTGG - Intergenic
900174566 1:1286077-1286099 TCCGCCTGGTCTGCTCCCGCGGG + Exonic
900604918 1:3519663-3519685 GCCGCCTGGTGTGCTGGAGCCGG - Intronic
900937604 1:5776358-5776380 GCCGCCTCGCATGCTGCACCGGG + Intergenic
901019085 1:6246879-6246901 GCCACCTGGTGGACTGCAGAGGG - Intergenic
901790364 1:11650623-11650645 GCCGCCTGGTGTGCCTGCGCTGG - Exonic
901791561 1:11655924-11655946 GCCGCCTGGTCTGCAGCCTCTGG + Exonic
901793794 1:11668768-11668790 GCCGCCTGGTCTGCAGCCTCTGG + Exonic
901957287 1:12795759-12795781 GCCCACTGGTGTGGCGCAGCAGG - Exonic
901965306 1:12861542-12861564 GCCCACTGGTGTGGCGCAGCAGG - Exonic
901973686 1:12928016-12928038 GCCCACTGGTGTGGCGCAGCAGG - Intronic
901980699 1:13031893-13031915 GCCCACTGGTGTGGCGCAGCAGG - Exonic
902001390 1:13197038-13197060 GCCCACTGGTGTGGCGCAGCAGG + Exonic
902011492 1:13273751-13273773 GCCCACTGGTGTGGCGCAGCAGG + Intergenic
903627918 1:24744910-24744932 GAGTCCTGGGGTGCTGCAGCGGG + Intergenic
904058110 1:27685722-27685744 TCCTCCTGATGAGCTGCAGCTGG + Intergenic
904382195 1:30119144-30119166 CCCGCCTGGGGGGCTGCAGTGGG + Intergenic
905515007 1:38556174-38556196 GACCCCTGCTGTGCTCCAGCCGG - Intergenic
906152211 1:43594128-43594150 AGCACCTGCTGTGCTGCAGCTGG - Intronic
906263083 1:44407648-44407670 GCCGCGCGGTGTGCGGCGGCCGG + Intronic
912144286 1:106773185-106773207 GCAGCCTCATGTGGTGCAGCAGG - Intergenic
1064552961 10:16521099-16521121 GCCGGCTGGTGGGCAGCAGGAGG - Exonic
1065201348 10:23316214-23316236 GCTGCCTGCCCTGCTGCAGCTGG - Intronic
1065304758 10:24357523-24357545 GCCTGCGGGTGTGCTGCTGCAGG - Intronic
1067497798 10:46775015-46775037 GGCGGCTGGTGTCCTGCAGGTGG + Intergenic
1067596851 10:47565399-47565421 GGCGGCTGGTGTCCTGCAGGTGG - Intergenic
1072625892 10:97111727-97111749 GCTCCCAGGTGAGCTGCAGCAGG - Intronic
1073660345 10:105468998-105469020 GCCACCTGGTGTGCTGCTTTAGG + Intergenic
1073774295 10:106768766-106768788 CACCCCTGGTGTGGTGCAGCTGG - Intronic
1074865527 10:117542502-117542524 GCCGCCCGGTGGGCGGCAGAAGG + Exonic
1075020208 10:118946564-118946586 GACCACTGGTGTGCTGGAGCGGG + Intergenic
1075668571 10:124247787-124247809 GCTGCCTGGTGTGCTCCACCTGG + Intergenic
1076620796 10:131786123-131786145 CCTGCCTGGTGTGCAGAAGCAGG - Intergenic
1076818166 10:132924751-132924773 GCCGCAGGTTGTGCTGCAGCAGG + Exonic
1077031847 11:471950-471972 GCGGCCTGGGGTGATGCAGATGG + Intronic
1077411919 11:2407654-2407676 CCCACCTGGTGTGCTGCAGAGGG - Intronic
1077458516 11:2695714-2695736 GCCTCCCTGTGTGCTGCAGGTGG - Intronic
1083417489 11:62535110-62535132 GCCCCATGGTGTTCAGCAGCTGG + Exonic
1083892145 11:65600814-65600836 CCTGCCTGGAGTGCAGCAGCAGG + Intronic
1083952779 11:65966068-65966090 GCCCCCAGGCGTGCTGCAGGAGG + Exonic
1084411363 11:69008059-69008081 GCAGCCTGCTGTGCTCCAGCTGG + Intronic
1084515981 11:69638236-69638258 GCCGCCAGGTATGCGGCTGCAGG + Intergenic
1085682398 11:78589463-78589485 GCCTCCCAGTGTGATGCAGCAGG + Intergenic
1088917860 11:114240688-114240710 TCCTCCTGTGGTGCTGCAGCTGG + Intronic
1089080967 11:115775963-115775985 GCCCTCTCGTATGCTGCAGCTGG - Intergenic
1091375613 12:22958-22980 TCCTCCTGCTCTGCTGCAGCCGG - Intergenic
1091397655 12:163513-163535 GCCGCCTGGTGTGCTGCAGCCGG + Exonic
1095812176 12:46383235-46383257 CCAGCCTGGGGCGCTGCAGCGGG + Intergenic
1096620043 12:52858757-52858779 CCTGCCTGCTGGGCTGCAGCAGG + Intergenic
1099437258 12:82659472-82659494 GCCGCCTGGTGGGCTTAATCAGG - Intergenic
1103055409 12:117816270-117816292 GCCACCTGGAGTTCTGCAGACGG + Intronic
1103324457 12:120111192-120111214 GGCGCCTGCTGTGCTGCAGTGGG - Intronic
1103337589 12:120201339-120201361 GCCACCTGCTGGGCTGGAGCTGG + Intergenic
1104809905 12:131613867-131613889 CCCGCCGGGTTGGCTGCAGCTGG - Intergenic
1104894374 12:132154558-132154580 ACCGCCTGGTGGGCAGCACCTGG - Intergenic
1105489114 13:20870386-20870408 CCAGGCTGGTGTGCAGCAGCGGG - Intronic
1106467592 13:30026579-30026601 CCCACCTTGTGGGCTGCAGCTGG - Intergenic
1108141876 13:47432069-47432091 GCCTCCTGCTGTGATGCAACAGG + Intergenic
1113914290 13:113861649-113861671 TGGGCCTGGTGTGCTGGAGCCGG + Intronic
1119079083 14:71675169-71675191 ACTCCCTGGTGTGCTGGAGCTGG - Intronic
1121396358 14:93626935-93626957 GCTGCTTGGAGTGCTGAAGCAGG + Intronic
1122793807 14:104195651-104195673 GCCGCATGGTGGGCAGCAGCAGG + Intergenic
1122861396 14:104584218-104584240 GCCCCCTGGAATGCTGCTGCAGG + Intronic
1124061540 15:26298096-26298118 GCCCCCTGCTCTGCAGCAGCCGG - Intergenic
1124660968 15:31550649-31550671 GCCGTCTGCTGTGCTTTAGCTGG - Intronic
1128647666 15:69388921-69388943 GGGGCCAGGTGTGCTTCAGCTGG - Intronic
1129520600 15:76183693-76183715 GCCGCCTGCTGTGGTGGAACCGG - Intronic
1130988366 15:88859469-88859491 GCCTCCTTCTGTGCTGCAGTAGG - Intronic
1132451313 15:101970041-101970063 TCCTCCTGCTCTGCTGCAGCTGG + Intergenic
1132725870 16:1338166-1338188 GCCTCCTGCTGTGCTGTCGCGGG + Intronic
1132754708 16:1477333-1477355 GCCTCCTGATGTGATGCACCAGG + Intergenic
1132994978 16:2818105-2818127 GCCCCAGGCTGTGCTGCAGCCGG + Intronic
1133639357 16:7701916-7701938 GCACCCTGGTTTGCTGCAACAGG - Intronic
1135292359 16:21250861-21250883 GCCGCCTGGAGTGCTGCCAGCGG - Exonic
1136394635 16:29986420-29986442 GCCGCTTGTTGTACTCCAGCTGG - Exonic
1138224454 16:55280872-55280894 CCCCCAGGGTGTGCTGCAGCTGG + Intergenic
1138335496 16:56249726-56249748 GCCAGCTGGTGTGCTGAGGCAGG - Intronic
1139473137 16:67188889-67188911 GCAGACTGGTGTGTGGCAGCTGG - Exonic
1141667930 16:85475424-85475446 GGCACCTGGTGTCCTGAAGCAGG + Intergenic
1141971556 16:87487504-87487526 CCAGCCTGGGGAGCTGCAGCTGG - Intronic
1142227336 16:88884039-88884061 GCCGCCTGTGAAGCTGCAGCTGG + Intronic
1142227355 16:88884160-88884182 GGCGTCTGGCATGCTGCAGCCGG - Intronic
1142382238 16:89739497-89739519 GCAGCCTGGTGTGCTGATCCGGG + Exonic
1142695030 17:1628779-1628801 GGAGCCGGGTGAGCTGCAGCAGG - Intronic
1145870714 17:28271044-28271066 GCCTCCTGCTGGGCTGCAGAGGG + Intergenic
1145905648 17:28514747-28514769 GCCGCCAGGTGGGAGGCAGCAGG + Intronic
1146083535 17:29805494-29805516 GTCCGCTGGTGTGCTGGAGCTGG + Intronic
1147522748 17:41190122-41190144 GCAGCAGGGTGTGCTGCAGCAGG - Exonic
1147524873 17:41213023-41213045 GCAGCAGGGTGTGCTGCAGCAGG - Intronic
1147526261 17:41226746-41226768 GCAGCAGGGTGTGCTGCTGCAGG - Exonic
1147526285 17:41226890-41226912 GCAGCAGGGTGTGCTGCAGCAGG - Exonic
1147526818 17:41232722-41232744 GCAGCAGGGTGTGCTACAGCAGG - Exonic
1147527300 17:41238128-41238150 GCAGCAGGGTGTGCTGCTGCAGG - Exonic
1147527320 17:41238257-41238279 ACAGCAGGGTGTGCTGCAGCAGG - Exonic
1147528424 17:41249812-41249834 GCAGCAGGGTGTGCTGCTGCAGG - Exonic
1147528445 17:41249941-41249963 GCAGCAGGGTGTGCTGCAGCAGG - Exonic
1147528944 17:41255462-41255484 GCAGCAGGGTGTGCTGCTGCAGG - Exonic
1147528967 17:41255606-41255628 GCAGCAGGTTGTGCTGCAGCAGG - Exonic
1147529850 17:41265469-41265491 GCAGCAGGGTGTGCTGCTGCAGG - Exonic
1147529874 17:41265613-41265635 GTAGCAGGGTGTGCTGCAGCAGG - Exonic
1147530845 17:41275774-41275796 GCAGCAGGGTGTGCTGCTGCAGG - Exonic
1147530869 17:41275918-41275940 GCAGCAGGGTGTGCTGCAGCAGG - Exonic
1147531312 17:41280752-41280774 GCAGCAGGGTGGGCTGCAGCAGG - Intergenic
1151683603 17:75634435-75634457 TCCGCCTGCTGTGCAGCAGAGGG + Intronic
1152688135 17:81704696-81704718 ACCTCCTGGGCTGCTGCAGCAGG - Exonic
1158697441 18:59715520-59715542 CCAGGCTGGTGTGCTGCTGCTGG + Intergenic
1159334444 18:67044517-67044539 GCTGCCTGCCCTGCTGCAGCTGG + Intergenic
1160633950 19:62506-62528 TCCTCCTGCTCTGCTGCAGCTGG - Intergenic
1161628618 19:5340308-5340330 GCAGCCCGGGGTGGTGCAGCCGG + Intronic
1162562752 19:11426920-11426942 GGCGCAGGCTGTGCTGCAGCTGG + Exonic
1163125499 19:15242249-15242271 GCCTCCTGATGTGGTGCTGCAGG - Intronic
1163441738 19:17325335-17325357 GCCGCCTGCGCTGCTGCTGCTGG + Exonic
1164302237 19:23972415-23972437 GCCTCCTGGGGTGCTCTAGCCGG - Intergenic
1167490276 19:49788988-49789010 GAACCCTCGTGTGCTGCAGCTGG - Intronic
926367246 2:12144704-12144726 GCCGACAGGTGTGGGGCAGCAGG - Intergenic
927342682 2:22000330-22000352 GCAGCCTTCTGTGCTGCAGAGGG + Intergenic
929658215 2:43755427-43755449 ACTGCCTGCTGTCCTGCAGCAGG + Intronic
929930362 2:46250925-46250947 GGCACCGTGTGTGCTGCAGCTGG - Intergenic
935064643 2:99636978-99637000 GCAGGGTGGTGTGCTCCAGCTGG + Intronic
936127546 2:109802407-109802429 TCCGGCTGGAGTGCAGCAGCTGG + Intronic
936217151 2:110569078-110569100 TCCGGCTGGAGTGCAGCAGCTGG - Intronic
936426291 2:112423662-112423684 TCCGGCTGGAGTGCAGCAGCTGG - Intronic
936567528 2:113592522-113592544 TCCTCCTGCTCTGCTGCAGCTGG + Intergenic
937928379 2:127185247-127185269 GCCTCCTGGTGTGATGTAGCAGG - Exonic
938308065 2:130267982-130268004 GTCGGCAGGTGGGCTGCAGCTGG + Intergenic
938447266 2:131388854-131388876 GTCGGCAGGTGGGCTGCAGCTGG - Intergenic
942660291 2:178256825-178256847 CTGGCCTGGTGTGCTGTAGCTGG - Intronic
946225760 2:218263306-218263328 GCCGGCAGATGTCCTGCAGCTGG - Exonic
947617273 2:231566309-231566331 GCTGGCAGGTGGGCTGCAGCTGG + Intergenic
948124602 2:235555548-235555570 ACCGCCAGCTGTCCTGCAGCAGG + Intronic
948601311 2:239108912-239108934 GCAGCCTGGGGCTCTGCAGCAGG + Intronic
1172991273 20:39038754-39038776 GCATCCTTCTGTGCTGCAGCGGG + Exonic
1173800191 20:45890500-45890522 ACCGCCTGGTGGGCCGCAGCCGG - Exonic
1173803953 20:45912012-45912034 GCCGCGTGGTGCACTGAAGCCGG - Exonic
1173906280 20:46632005-46632027 GCTCCCTGCTGGGCTGCAGCTGG + Intronic
1174504697 20:51009706-51009728 GCCGCCTGGGGCGCTGCATGCGG - Exonic
1174870040 20:54173694-54173716 GCCAGCTGGTGTGATGGAGCGGG + Exonic
1175387822 20:58608551-58608573 GCTGCCTGGTTTCCTTCAGCTGG - Intergenic
1176424217 21:6538095-6538117 GCCTCTGGGTGAGCTGCAGCAGG - Intergenic
1178349777 21:31864454-31864476 AGCTCCTGGTGTGCTGCTGCTGG + Intergenic
1179699710 21:43146410-43146432 GCCTCTGGGTGAGCTGCAGCAGG - Intergenic
1179888505 21:44324673-44324695 GCCGGCAGGTCTGCCGCAGCAGG - Intronic
1180650033 22:17369758-17369780 GCCGCCGCCTGTGCCGCAGCGGG + Exonic
1181319154 22:21991411-21991433 GCCCCATGGTGTGCTCCAGCAGG + Intergenic
1181467660 22:23118798-23118820 GCCCACAGGTGGGCTGCAGCAGG + Intronic
1183294023 22:37019463-37019485 GCCGCCTGGGGAGCTGCGGCCGG - Exonic
1183674753 22:39292910-39292932 GCGGGCTGGTTTGCTGAAGCCGG + Intergenic
1184211869 22:43040863-43040885 CCCGTCTGGGGAGCTGCAGCTGG - Intronic
1184245529 22:43234046-43234068 CCAGCGTGATGTGCTGCAGCAGG - Intronic
1184732263 22:46377476-46377498 GGAGCCTGGCGTGCTGCCGCAGG - Intronic
1184839207 22:47042776-47042798 GCAGCCTGTTCTGCTGCCGCTGG + Intronic
1185086292 22:48742707-48742729 GCCGGGTGGTGTGGTGAAGCCGG + Intronic
951626169 3:24665560-24665582 CCCTCCTTGTGTGCTTCAGCAGG - Intergenic
953350172 3:42209623-42209645 GCCTCCAGGTGGACTGCAGCGGG - Intronic
954423540 3:50431368-50431390 ACAGCCAGGGGTGCTGCAGCAGG + Intronic
955349826 3:58185147-58185169 AGAGCCTGGAGTGCTGCAGCTGG - Intergenic
957506294 3:81125483-81125505 TCCGCCTGGAGAGCTGCAGTGGG + Intergenic
961375081 3:126459628-126459650 GAGGCCGTGTGTGCTGCAGCCGG - Intronic
964356207 3:155854150-155854172 GCAGCCCGGAGTGCTGAAGCCGG + Exonic
964778674 3:160310746-160310768 GCCTCCTGATGTGATGCAACAGG + Intronic
965530734 3:169768019-169768041 GCCTCATGGTGTGCAGCAACTGG - Exonic
967258098 3:187613695-187613717 GCTGCCTGGCATGCAGCAGCAGG + Intergenic
968683895 4:1943137-1943159 GCAGCCTGGTGTCCTGCCCCAGG + Intronic
968834887 4:2955809-2955831 GCCTCCTGGTGTGCCGCAGATGG + Intronic
969577979 4:8047452-8047474 CCCACCTGGTGTGTTGCACCAGG - Intronic
969721511 4:8895037-8895059 GCTGCCTGGGGAGCAGCAGCAGG - Intergenic
972727877 4:41761418-41761440 GCCTCCTGGTATGGTGCAGGAGG - Intergenic
974644107 4:64670916-64670938 GCTGCCTGTCCTGCTGCAGCTGG - Intergenic
976732519 4:88278484-88278506 CCCGCCTGTCGTCCTGCAGCAGG + Exonic
977771713 4:100868530-100868552 TCCACCTGCTATGCTGCAGCTGG - Intronic
978822164 4:112979247-112979269 GCTGCCTGCCTTGCTGCAGCCGG - Intronic
980994616 4:139768720-139768742 GCACCATGGGGTGCTGCAGCAGG - Intronic
981670171 4:147277492-147277514 GCTGCCAGGTATGCTGGAGCAGG - Intergenic
983885301 4:172974794-172974816 GCTGCCTGCCCTGCTGCAGCCGG - Intronic
985793342 5:1944535-1944557 GCCTCCTGCTGTGCTGCTCCAGG - Intergenic
986693983 5:10335896-10335918 TGCCTCTGGTGTGCTGCAGCAGG + Intergenic
988468489 5:31514022-31514044 GGCGCCTGTGGTGCTACAGCCGG - Intronic
992031248 5:72723623-72723645 GAAGCCTGGTGTCCTTCAGCAGG - Intergenic
995065872 5:107861922-107861944 GCTCACTGATGTGCTGCAGCTGG + Intronic
996176896 5:120369468-120369490 GCTGCCTGCTCTGCTGCAGCTGG + Intergenic
998152272 5:139764356-139764378 TCCGCCTGGGCTGCTGCAGCTGG + Intergenic
998822220 5:146067275-146067297 GCCGCCTGGGTTGCTGCTGCCGG - Intronic
998825026 5:146092651-146092673 GCTGCCTGGGATGCTGAAGCAGG - Intronic
1001282360 5:170395929-170395951 GTCCCTAGGTGTGCTGCAGCTGG + Intronic
1004216646 6:13710790-13710812 GCCGCCTGTTGTGCTGCTCCGGG - Intronic
1004438894 6:15627472-15627494 CCCTTCTTGTGTGCTGCAGCTGG - Exonic
1004473763 6:15952107-15952129 GCCTCCTGGTTTGCTCCAGTGGG + Intergenic
1005961976 6:30700518-30700540 GCTGACTGGAGTGCTGAAGCAGG - Exonic
1006431095 6:33996354-33996376 TCCCCCTGAAGTGCTGCAGCTGG + Intergenic
1007171371 6:39865651-39865673 GCCCCGTGGTGTGCTGGAACTGG + Intronic
1007400825 6:41601330-41601352 GCAGGCTGGTGTGCTGGGGCTGG - Exonic
1008381857 6:50845924-50845946 GGCGCCCGGTGGGCTGCAGGTGG + Exonic
1010249895 6:73696372-73696394 GGCGGCTGCTGTGCAGCAGCGGG + Intronic
1018217207 6:161540080-161540102 GCCGCCAGGTCTGCCCCAGCTGG + Intronic
1019899012 7:4005466-4005488 GCCTCCTTGGGTGATGCAGCAGG - Intronic
1022739786 7:33109609-33109631 GCCGCCAGGCGGGCTGCTGCGGG + Intergenic
1023482885 7:40653652-40653674 GCTGCCTGGTCAGCTGCAGGAGG + Intronic
1024222540 7:47299769-47299791 GGAGCCTGGTGTGCTGAAGTTGG + Intronic
1026460976 7:70614899-70614921 GCTGCCTGGGGTGCTGGTGCAGG - Intronic
1027241279 7:76331159-76331181 CCAGCCTGGAGTGCAGCAGCAGG + Intronic
1029216343 7:98953217-98953239 GCAGCGTGGCGTACTGCAGCAGG - Exonic
1030771485 7:113480814-113480836 GCCAGCTGGTTTGCTCCAGCTGG - Intergenic
1032548994 7:132766879-132766901 ACTGACTGGTGAGCTGCAGCAGG + Intergenic
1034343572 7:150372420-150372442 GCTCCCCGGTGTGCTGCCGCTGG - Exonic
1034531171 7:151697245-151697267 CAGGCCTGGTGGGCTGCAGCTGG - Intronic
1034893599 7:154860707-154860729 GCCTCCTTGGGTGCAGCAGCAGG + Intronic
1035685730 8:1522366-1522388 GCTGGCAGGTGTGCAGCAGCCGG + Intronic
1035763515 8:2086781-2086803 GGCGCCTGGAATGTTGCAGCAGG - Intronic
1036915346 8:12799128-12799150 GCTGCCTGCCCTGCTGCAGCTGG - Intergenic
1037095659 8:14983307-14983329 GCCACCTGGTGTGCTGAGGCAGG - Intronic
1038120765 8:24612173-24612195 GCTGCCTGCTGTGGAGCAGCCGG - Intergenic
1038472748 8:27838980-27839002 GCAGCCTGGAGGGCTGCAGATGG + Intergenic
1044728887 8:95214521-95214543 GCTGTCTGCTGAGCTGCAGCTGG - Intergenic
1049367929 8:142249640-142249662 TCCGCCCAGGGTGCTGCAGCAGG + Intronic
1049427667 8:142544587-142544609 GCCGCCTCCTGTCCTGCATCTGG - Exonic
1049514749 8:143048152-143048174 GCTGCCTGGTTGGCTGCCGCTGG + Intronic
1049538380 8:143193707-143193729 GGCGGCTGGTGGGCGGCAGCAGG - Intergenic
1049639287 8:143707278-143707300 GCCGCGTGTGGTGCAGCAGCTGG + Exonic
1049690959 8:143958689-143958711 GGCACCTGCTCTGCTGCAGCAGG + Intronic
1049726264 8:144147944-144147966 GCAGCCTGGAGCGCGGCAGCAGG - Intergenic
1049885005 9:21011-21033 TCCTCCTGCTCTGCTGCAGCTGG - Intergenic
1050355504 9:4779218-4779240 TCCCCCTGCTGTGCTCCAGCTGG + Intergenic
1054872182 9:70057874-70057896 ACCACCAGGTGTGCTGCAGAAGG + Intronic
1056164964 9:83932222-83932244 GCCTCCTGGTGTGTTGCAACAGG - Intergenic
1056773662 9:89497209-89497231 GCCGCCTAGTGAGCTGCAAGGGG - Intronic
1058923609 9:109640828-109640850 GCGGCCGGGTGCGCTGCTGCGGG - Intronic
1060651582 9:125332025-125332047 GAGGCCTGGTGTGCTGGGGCGGG - Exonic
1060655075 9:125366270-125366292 GCTGACTGGTGTGCTGAACCCGG + Intronic
1061975409 9:134065886-134065908 GCAGCCAGGCCTGCTGCAGCCGG - Intronic
1062092747 9:134687091-134687113 GCCGCCTGGTGCCCTGAAGCTGG + Intronic
1062472512 9:136712650-136712672 GCCGCATGGTGGGCTCCGGCCGG - Exonic
1062549506 9:137079442-137079464 GTCACCAGGTGTGCGGCAGCAGG + Exonic
1187410719 X:19048499-19048521 GCGGCCTGGTGTAGTGAAGCTGG - Intronic
1187698115 X:21940919-21940941 GCCGCCTGGCGGGCTGGGGCGGG + Intronic
1192624547 X:72714123-72714145 GGCGCCTGGGGCGCTGCGGCGGG - Intronic
1201177958 Y:11321462-11321484 GCCGGCGAGTGCGCTGCAGCAGG - Intergenic