ID: 1091398683

View in Genome Browser
Species Human (GRCh38)
Location 12:170001-170023
Sequence GACTCAGGGCCGACTGTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 102}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091398683_1091398691 3 Left 1091398683 12:170001-170023 CCCGCCACAGTCGGCCCTGAGTC 0: 1
1: 0
2: 0
3: 17
4: 102
Right 1091398691 12:170027-170049 ACTTGGAACAGGCAGCAGCGTGG 0: 1
1: 0
2: 0
3: 9
4: 148
1091398683_1091398693 5 Left 1091398683 12:170001-170023 CCCGCCACAGTCGGCCCTGAGTC 0: 1
1: 0
2: 0
3: 17
4: 102
Right 1091398693 12:170029-170051 TTGGAACAGGCAGCAGCGTGGGG 0: 1
1: 0
2: 1
3: 13
4: 168
1091398683_1091398695 24 Left 1091398683 12:170001-170023 CCCGCCACAGTCGGCCCTGAGTC 0: 1
1: 0
2: 0
3: 17
4: 102
Right 1091398695 12:170048-170070 GGGGACTAGTTACGGCAGCGAGG 0: 1
1: 0
2: 0
3: 3
4: 32
1091398683_1091398689 -8 Left 1091398683 12:170001-170023 CCCGCCACAGTCGGCCCTGAGTC 0: 1
1: 0
2: 0
3: 17
4: 102
Right 1091398689 12:170016-170038 CCTGAGTCCTGACTTGGAACAGG 0: 1
1: 0
2: 1
3: 17
4: 151
1091398683_1091398692 4 Left 1091398683 12:170001-170023 CCCGCCACAGTCGGCCCTGAGTC 0: 1
1: 0
2: 0
3: 17
4: 102
Right 1091398692 12:170028-170050 CTTGGAACAGGCAGCAGCGTGGG 0: 1
1: 0
2: 0
3: 11
4: 131
1091398683_1091398694 16 Left 1091398683 12:170001-170023 CCCGCCACAGTCGGCCCTGAGTC 0: 1
1: 0
2: 0
3: 17
4: 102
Right 1091398694 12:170040-170062 AGCAGCGTGGGGACTAGTTACGG 0: 1
1: 0
2: 0
3: 6
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091398683 Original CRISPR GACTCAGGGCCGACTGTGGC GGG (reversed) Intronic
900363914 1:2302855-2302877 CACTCAGGGTCGTTTGTGGCCGG + Intronic
900963914 1:5944380-5944402 GGCCCAGGGCGGGCTGTGGCAGG - Intronic
902411789 1:16216126-16216148 GACGCAGGGGCGAGTGAGGCAGG - Intergenic
905823462 1:41012163-41012185 TTCTCAGTGCCAACTGTGGCTGG + Exonic
905973205 1:42156204-42156226 TAATCAGGGCCGACTCTGCCTGG + Intergenic
906215087 1:44033927-44033949 GACTGAGGACAGACTGGGGCAGG + Intergenic
911039195 1:93578780-93578802 GACTGAGCGCCTACTGTGCCAGG - Intronic
915044158 1:152997849-152997871 GCCTCAGGGTCCAGTGTGGCTGG + Intergenic
915662894 1:157418387-157418409 AACCCAGGGCAAACTGTGGCAGG - Intergenic
916855188 1:168741848-168741870 GCCTCAGAGCAGACTGTGGAAGG - Intergenic
918216887 1:182399643-182399665 GAGACAGGGCCTACAGTGGCTGG - Exonic
922673433 1:227532560-227532582 GACTCAGGGCTGTTGGTGGCAGG - Intergenic
1066467192 10:35663023-35663045 GATTCAGGGACGTGTGTGGCGGG + Intergenic
1069942670 10:71965672-71965694 GACTGAGTGCCCACTGTGCCAGG - Intronic
1075376092 10:121978857-121978879 GCCTCAGCGCCCACTCTGGCCGG - Intergenic
1076282694 10:129262536-129262558 TTCTGAGGGCCCACTGTGGCAGG + Intergenic
1076483519 10:130800639-130800661 GACTCAGGGACTATTGTGGTGGG + Intergenic
1076912074 10:133395431-133395453 GACTCATGGCTGACTCTGGGTGG - Intronic
1077343931 11:2037795-2037817 GACTCAGGGACGGCTGTGGGAGG + Intergenic
1086032281 11:82374538-82374560 GACACAGAGCCCACTGAGGCTGG + Intergenic
1202826917 11_KI270721v1_random:92984-93006 GACTCAGGGACGGCTGTGGGAGG + Intergenic
1091398683 12:170001-170023 GACTCAGGGCCGACTGTGGCGGG - Intronic
1096509827 12:52121584-52121606 GCCTCAGGGCCCTCTGAGGCTGG + Intergenic
1103348437 12:120266026-120266048 GACACATGGCTGACTGTGGACGG - Intergenic
1105705267 13:22964412-22964434 GAGTCAGGGCGGGCTCTGGCAGG - Intergenic
1112475743 13:99729819-99729841 GCCACAGGGCCGACGGTGGCAGG - Intronic
1113942041 13:114023369-114023391 GTCTCAGGGCCGGCTGGGGAGGG + Intronic
1114353263 14:21878195-21878217 GACTCACGGAGGACTCTGGCTGG - Intergenic
1116896856 14:50324364-50324386 TACTGAGGGCTTACTGTGGCAGG - Intronic
1118791060 14:69093665-69093687 GACACAGGACTGACTGGGGCTGG - Intronic
1119427525 14:74545544-74545566 GGCTCAGGGCCTACAGTGGTGGG - Intronic
1120741508 14:88113633-88113655 GACTCAGGGCCAAGTGTGCCTGG + Intergenic
1122789780 14:104179340-104179362 GACCCAGGGCCGGCTGATGCTGG + Exonic
1123042066 14:105494352-105494374 GGCACAGGGCTGACTGTGGGAGG + Intronic
1124654130 15:31494983-31495005 GAATCAGGGGCGATGGTGGCTGG + Intronic
1132512800 16:352601-352623 GGCTCCGGGCCGACTCCGGCCGG + Exonic
1133019715 16:2961983-2962005 GACTGAGGCCAGACTGGGGCAGG - Intergenic
1133203354 16:4218118-4218140 GAATCAGGGCTGACTGAGGCTGG - Intronic
1135143802 16:19944198-19944220 GAATCAGAACCTACTGTGGCAGG - Intergenic
1135991688 16:27222471-27222493 GAGTCACAGCCCACTGTGGCCGG - Intergenic
1136479720 16:30533985-30534007 GACTCAGGGGCGGGTATGGCAGG + Intronic
1138105392 16:54284953-54284975 GACTCAGGACCGGTAGTGGCCGG + Exonic
1141561222 16:84868932-84868954 GACTCAGAGGCTACAGTGGCAGG - Intronic
1142143183 16:88481615-88481637 GACTCGGTGACGGCTGTGGCAGG - Intronic
1143408349 17:6693012-6693034 GGCTCTGGGCAGCCTGTGGCTGG + Intronic
1146473842 17:33145931-33145953 GTCTCTGGGTCGGCTGTGGCGGG - Intronic
1147167437 17:38600991-38601013 GACTCTGGGCCGGGTGTGGGCGG + Intronic
1147722343 17:42546979-42547001 AACACAGGGCCGGCTGTGGGAGG + Intergenic
1147723531 17:42553149-42553171 AACACAGGGCCGGCTGTGGGAGG + Exonic
1148795501 17:50194883-50194905 GCCTCAGAGCCGGCTGAGGCTGG + Intronic
1156461912 18:37326045-37326067 GAGTCAGGGCTGAGTGAGGCTGG - Intronic
1158498860 18:57982345-57982367 GACCCAGGGCAGGCTCTGGCAGG - Intergenic
1159002652 18:62987702-62987724 GACTCAGTGGGGACTGAGGCTGG - Intergenic
1160681189 19:412375-412397 GACTCAGGGCGGAGAGGGGCTGG - Intergenic
1161089146 19:2351672-2351694 GCCGCAGGGCTGGCTGTGGCTGG - Intronic
1161219034 19:3109524-3109546 TGCTCAGGGCCACCTGTGGCAGG + Intronic
1162376481 19:10308396-10308418 GACTCAGGGCCGCCTGCTGCTGG - Exonic
1165743761 19:38218472-38218494 GACTGAGGTCAGACTGTGGCAGG + Intronic
1166270483 19:41710431-41710453 GACTCAGGGGAGCCTGTGCCAGG + Intronic
1167294257 19:48640051-48640073 GACTCAGGGCGGAGGGTGGCGGG + Intronic
925021769 2:575350-575372 GAGTCAGGGGCGAGGGTGGCAGG - Intergenic
928027375 2:27751422-27751444 GACTCCAGGCCGGCTGTGGCAGG + Intergenic
932437965 2:71714123-71714145 GAATCAGGGCTGAGTGTGGCTGG + Intergenic
934757202 2:96832555-96832577 GACGCCGGGCCTGCTGTGGCTGG - Exonic
935631944 2:105219243-105219265 GGCTCAAGGAAGACTGTGGCAGG + Intergenic
937849312 2:126618727-126618749 GACTCTGGGCTCACTGTGGCAGG + Intergenic
939099585 2:137880617-137880639 GACTGAGAGCCGCCTGTGCCAGG + Intergenic
945286223 2:208085180-208085202 GACTCAGGGGCAAGTGTGGGAGG + Intergenic
945484436 2:210378198-210378220 AACTCAGGGCTCACTGTGGCAGG - Intergenic
1172637802 20:36421732-36421754 GAATCGGGGCAGACTGTGGGCGG + Intronic
1178721508 21:35014742-35014764 GGCTCAGCCCCGTCTGTGGCTGG - Intronic
1179887460 21:44320302-44320324 GGCTCAGGCACCACTGTGGCTGG + Intronic
1179991082 21:44948572-44948594 GACTCAGAGCCGGGTGGGGCTGG + Intronic
1181798472 22:25327559-25327581 AAGTCAGCTCCGACTGTGGCTGG + Intergenic
953808267 3:46090371-46090393 GACTGTGGGCCGTCTGAGGCTGG + Intergenic
961373860 3:126449673-126449695 GACTCCTGGCCGTCAGTGGCAGG - Intronic
961647050 3:128398182-128398204 TACTCAGGGCAGAGTGTGGGGGG + Intronic
968607455 4:1542259-1542281 GACTCTGGGGGGAGTGTGGCTGG - Intergenic
968742649 4:2339312-2339334 GGTTCAGGGCCGCCTGTGGGTGG - Intronic
973316565 4:48766586-48766608 TACTCAGGGCCCCCTGTGACTGG - Intronic
975961543 4:79913778-79913800 GACTCAGAGGTCACTGTGGCTGG + Intronic
977689255 4:99886364-99886386 GACTCATGTCCGACTTTGGACGG + Intronic
978370187 4:108022337-108022359 TACTGAGGGCTGACTGTGCCGGG + Intronic
979250497 4:118562216-118562238 GACTAGGGGCTGACTATGGCTGG + Intergenic
985646684 5:1088273-1088295 GACTCAGGGCCGCGGCTGGCGGG + Intronic
986275815 5:6274216-6274238 GACTCAGCGTTGACAGTGGCGGG + Intergenic
987090233 5:14503680-14503702 GAATCAGGGCTGCCTGGGGCTGG - Intronic
1001559210 5:172658511-172658533 GCCTCAGAGCCGAGTGTGGCTGG + Intronic
1001990480 5:176112292-176112314 TGCTCAGGGCCCTCTGTGGCTGG + Intronic
1002226392 5:177725848-177725870 TGCTCAGGGCCCTCTGTGGCTGG - Intronic
1002267455 5:178045365-178045387 TGCTCAGGGCCCTCTGTGGCTGG + Intronic
1002772363 6:300871-300893 GACTCAGGGGCAACCTTGGCAGG + Intronic
1004361547 6:14975696-14975718 GACTCTGAGCCTACTCTGGCTGG + Intergenic
1004517952 6:16336672-16336694 GACTCAGGGGAGCCTGTGCCAGG - Intronic
1005019320 6:21402415-21402437 GACTCTGGGCAGCCTGTGGTTGG - Intergenic
1009868255 6:69424890-69424912 GACTCTGGTCTGAATGTGGCAGG - Intergenic
1013009052 6:106103665-106103687 GAGACAGGGCTGGCTGTGGCAGG + Intronic
1019487669 7:1296684-1296706 GCGTCAGGGTCGACTGTGTCTGG + Intergenic
1024629010 7:51231960-51231982 CACTCAGGTCCGACCATGGCAGG - Intronic
1027505849 7:79016527-79016549 AACTCAGGGGAGACTGTGGTAGG - Intronic
1034424471 7:151007328-151007350 GAATCAGGGCAGAGTGAGGCAGG - Intronic
1035075019 7:156171557-156171579 GACTCAGGGACGACGGAGGCAGG + Intergenic
1035237259 7:157506552-157506574 GACTCTGGGCGGACTCTAGCTGG - Intergenic
1036285691 8:7442691-7442713 CACTCAGGCCCGAATGTGGCTGG - Intronic
1036335782 8:7868838-7868860 CACTCAGGCCCGAATGTGGCTGG + Intronic
1049002371 8:139834157-139834179 GACTCAGCTCCCACTGTGACAGG - Intronic
1049635922 8:143689409-143689431 GAGGCAGGACCCACTGTGGCAGG + Intronic
1056001076 9:82216808-82216830 GAGTCAGGCCCCTCTGTGGCAGG - Intergenic
1058417723 9:104805695-104805717 GTCACAGGACAGACTGTGGCAGG - Intronic
1059123978 9:111666029-111666051 GAATCTGGGCTGACTGTGGCTGG - Intronic
1062118859 9:134823173-134823195 GACCCATGGCGGACTGAGGCAGG + Intronic
1062465063 9:136677315-136677337 GACACAGGGCTGCCTGTGCCTGG - Intronic
1062494942 9:136827215-136827237 GACTCAGTGCCCACTGTGCGAGG + Intronic
1203553843 Un_KI270743v1:189534-189556 GACACAAGGTCTACTGTGGCTGG - Intergenic
1186893162 X:13980093-13980115 GACTAAGGTCCAACTGTGGAAGG + Intergenic
1188011383 X:25059962-25059984 GACTCTGGGCCCACTGTACCTGG + Intergenic
1189969938 X:46407904-46407926 GATTCAAGGCCGAATGAGGCAGG + Intergenic
1190730313 X:53221559-53221581 AGCTCAGGTCCGATTGTGGCAGG + Intronic
1191976668 X:66879398-66879420 TACTCAGGGGTGACTGAGGCAGG - Intergenic
1199743668 X:150758314-150758336 GACACAAGGCAGACTGAGGCGGG - Intronic