ID: 1091402055

View in Genome Browser
Species Human (GRCh38)
Location 12:187100-187122
Sequence TTTTTGCAGCAGAAGCCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 252}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091402055_1091402059 24 Left 1091402055 12:187100-187122 CCTCAGGGCTTCTGCTGCAAAAA 0: 1
1: 0
2: 4
3: 36
4: 252
Right 1091402059 12:187147-187169 CAAATTGTAGCTGCCAGATTTGG 0: 1
1: 0
2: 2
3: 6
4: 121
1091402055_1091402056 0 Left 1091402055 12:187100-187122 CCTCAGGGCTTCTGCTGCAAAAA 0: 1
1: 0
2: 4
3: 36
4: 252
Right 1091402056 12:187123-187145 TCAATTTTTTCATGCCACACTGG 0: 1
1: 0
2: 0
3: 14
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091402055 Original CRISPR TTTTTGCAGCAGAAGCCCTG AGG (reversed) Intergenic
900437409 1:2637800-2637822 TTGTAGCAGCAGCAGCCCCGAGG - Intronic
900926788 1:5711024-5711046 TATTTTAAGCAGAAACCCTGTGG + Intergenic
901803176 1:11721103-11721125 TGCTTGCATCAGAACCCCTGGGG - Exonic
902616758 1:17627913-17627935 CTTTTGCGGCAGCAGCCCTAGGG - Intronic
903845665 1:26278619-26278641 TTTAAGCAGCAGGAGCCCAGAGG - Exonic
906253327 1:44328413-44328435 TTTCAGAATCAGAAGCCCTGGGG + Intronic
908564399 1:65339815-65339837 TTTTTGCCCCAGAAGCCCAGGGG - Intronic
909641672 1:77874970-77874992 ATCTTGAAGCAGATGCCCTGAGG + Exonic
910064144 1:83132740-83132762 TTTATGCAAAGGAAGCCCTGTGG - Intergenic
912965697 1:114235350-114235372 CTTTTTCTCCAGAAGCCCTGAGG + Intergenic
919510912 1:198462834-198462856 ATTTTGCAGTACAGGCCCTGAGG + Intergenic
919554079 1:199029706-199029728 TTTTTGCAGCTGAGGTCCAGAGG - Intergenic
920756418 1:208738151-208738173 TGTTTACAGCAGAAGCCCGGTGG + Intergenic
923398360 1:233590180-233590202 TTTTTGCATCAGGAGCCTTGGGG - Intergenic
923907806 1:238404634-238404656 TTGCTGCAGCAGAACCACTGGGG - Intergenic
1063017969 10:2096865-2096887 CCTGTGCAGCAGAGGCCCTGGGG - Intergenic
1064035831 10:11912734-11912756 TTGTTGCAGCAGAAGCCCAGAGG - Intergenic
1066095814 10:32070854-32070876 TTTGTGCAGCTGAAACCCAGGGG - Intergenic
1067229255 10:44395432-44395454 GTTTTCCAGGAGCAGCCCTGTGG + Intergenic
1071863694 10:89702199-89702221 TTTTTGCGGGGGGAGCCCTGTGG + Intronic
1072502711 10:96034392-96034414 TTTCTGAATCAGAAACCCTGGGG - Intergenic
1074002113 10:109383797-109383819 TATTTGCAGAAGAAGCCTTCAGG - Intergenic
1074378545 10:112959505-112959527 TTGTTGCAGCAGAATTTCTGAGG + Intronic
1074409005 10:113208070-113208092 TTTTTTCAGCAGAAACTTTGCGG + Intergenic
1074615104 10:115059746-115059768 TTTGGGCAGCAGATGCCCTGTGG + Intergenic
1074892598 10:117747968-117747990 TGTGTGCAGCGGAGGCCCTGTGG + Intergenic
1075330124 10:121567824-121567846 TCATTGCAACAGAAACCCTGTGG + Intronic
1076741822 10:132489402-132489424 TGTTTGCAGGAGGTGCCCTGAGG + Intergenic
1078352535 11:10606321-10606343 TTCTTGTAGCTGAAACCCTGAGG + Intronic
1078562715 11:12387328-12387350 TTTTTTCTGCAGATGCCATGAGG + Intronic
1078630168 11:12995447-12995469 TGTTATCAGCAGAAGTCCTGAGG + Intergenic
1079158304 11:17969455-17969477 TCTTAGCTGCAGAAGCCCTGGGG - Intronic
1079444157 11:20544807-20544829 AATTTGCTGCAGAAGCCCTAAGG + Intergenic
1080368069 11:31600461-31600483 GTTTAGCTGCAGCAGCCCTGTGG + Intronic
1082285652 11:50315406-50315428 TTTTTTCAGCTGAAGCCTTGGGG + Intergenic
1083695532 11:64439749-64439771 TATTTGCATCAGCATCCCTGTGG - Intergenic
1084216914 11:67652488-67652510 ATTTTGCAGAAGAAACCCTGGGG + Intergenic
1085252816 11:75154751-75154773 TTTTGGCACCAGAGACCCTGGGG - Intronic
1087873776 11:103331339-103331361 TTTTTGTACCAGAAACCTTGGGG + Intronic
1089295234 11:117463458-117463480 TGCTTGAAGCAGAAGCTCTGGGG + Intronic
1089488868 11:118869040-118869062 ACTTTGCAGTAGAAGCCCTTTGG - Intergenic
1091402055 12:187100-187122 TTTTTGCAGCAGAAGCCCTGAGG - Intergenic
1093823402 12:23650696-23650718 TTTCTGCATCAGAAACACTGGGG - Intronic
1094332867 12:29315305-29315327 TGGCTGCAGCAGAAGCACTGAGG + Intronic
1095593370 12:43931232-43931254 ATTAGGCAGCAGAAGCCCTCAGG - Intronic
1101434822 12:104655487-104655509 TTTTGGGAGCAGGAGTCCTGGGG + Intronic
1102544058 12:113641925-113641947 TTTGAGCACCAGAAACCCTGCGG + Intergenic
1102755348 12:115335254-115335276 AGTTGGGAGCAGAAGCCCTGGGG - Intergenic
1102903711 12:116658897-116658919 TTGTTGCAGCAGCTGCCCTGGGG + Intergenic
1103811469 12:123617670-123617692 TTTTAGCTGCAGCAGCCATGTGG + Intronic
1103966718 12:124644698-124644720 TTTTAGAAGCAGAAACCCAGGGG + Intergenic
1105611020 13:21969848-21969870 TTCCTGCAGCAGCAGCCCGGCGG - Intergenic
1106131239 13:26941182-26941204 TTTTTGCAGCTGCAGAACTGAGG - Intergenic
1106256568 13:28027663-28027685 TTTCTGCAGCAGCAGGCCTGGGG - Intronic
1106358223 13:29005189-29005211 TTTTGGCAGCAGAGCTCCTGTGG + Intronic
1107064486 13:36197793-36197815 ATGTTGCAGCAGGAGCTCTGTGG - Intronic
1107544281 13:41422209-41422231 TTCTGGCAGCACCAGCCCTGGGG - Intergenic
1107826196 13:44331021-44331043 TTTTTGGAGTAGAAGCCCGAGGG - Intergenic
1108089161 13:46828633-46828655 TTTATGCAGGAGATGCTCTGAGG - Intergenic
1108317273 13:49248931-49248953 TCTTTCCAGCAGAAGCCCAGCGG + Exonic
1108409025 13:50129565-50129587 TGTTTGCAGGAGAAGCCCCAGGG - Intronic
1109411518 13:61975650-61975672 TTTTTCCAGCAATAGCCTTGAGG - Intergenic
1111813510 13:93121109-93121131 TTTCTGCATCAGAAACTCTGAGG + Intergenic
1113068314 13:106393658-106393680 AGTTTGCAGCCGAAGGCCTGAGG - Intergenic
1113705310 13:112427464-112427486 TTTTTGCATCTGTATCCCTGGGG + Intronic
1113976370 13:114230818-114230840 TTATTTGAGCACAAGCCCTGAGG - Intergenic
1114721188 14:24883794-24883816 CTTTTGCAGAAGAATCCCAGGGG - Intronic
1116529078 14:45945196-45945218 TTTTTGTAGCAAAATCCCTAAGG - Intergenic
1118007541 14:61577139-61577161 ATTTTGCAGCAGATTCCCTTTGG - Intronic
1119564416 14:75616434-75616456 TCTTTGCACCAGAGTCCCTGAGG - Intronic
1120115175 14:80608008-80608030 TCGTTGCAGCAAAGGCCCTGAGG - Intronic
1120383491 14:83813080-83813102 TTTTTCTAACAGAAGACCTGTGG + Intergenic
1120551858 14:85882453-85882475 TTTTTGCATCAGAAACCGTAAGG + Intergenic
1120893340 14:89508647-89508669 TTTGGGCATCAGAAGCCCTGGGG - Intronic
1121870270 14:97400875-97400897 TTTGTGCTGAAGAAGCCCTAAGG + Intergenic
1121870283 14:97400945-97400967 TTTGTGCTGAAGAAGCCCTAAGG + Intergenic
1125255333 15:37757054-37757076 ATTTTGCAGCAGAAGTCATTAGG - Intergenic
1129179394 15:73862940-73862962 GTTTTGCAATTGAAGCCCTGAGG - Intergenic
1129700090 15:77762836-77762858 GTATTGCAGCAAAAGCCCTGGGG - Intronic
1130062261 15:80578477-80578499 TGTCTGCAGCAGCAGCCGTGGGG + Intronic
1131751041 15:95508581-95508603 TTTTTGTATCAGAAACTCTGGGG - Intergenic
1132793850 16:1708613-1708635 TTGGTTCAGCAGGAGCCCTGGGG - Intronic
1132877547 16:2147089-2147111 CTTCTGCAGCTGCAGCCCTGGGG - Intronic
1133008886 16:2899207-2899229 ATTTGGCCCCAGAAGCCCTGCGG - Exonic
1133122104 16:3615392-3615414 TTACTCCAGCAGAAGCCCTGGGG + Intronic
1133582461 16:7159254-7159276 TTTTTTCAGTAGACACCCTGAGG + Intronic
1135585885 16:23670541-23670563 TTTTTTCAGGAGAACCGCTGAGG - Exonic
1138880094 16:61002734-61002756 TTGTTTCAACAAAAGCCCTGGGG + Intergenic
1139559748 16:67734538-67734560 ATTTTGCAGAGGATGCCCTGTGG - Intronic
1140422454 16:74831803-74831825 ATTTTTCAGCAGAAGCCATTTGG + Intergenic
1140441614 16:74992186-74992208 TTTTTGCTGCCAAAGCCCTTTGG - Intronic
1141135241 16:81460493-81460515 TTTTTGCAGTGAAAGTCCTGTGG + Intronic
1141135814 16:81464531-81464553 TTTTGGCAGCTGAAGTTCTGAGG + Intronic
1143263897 17:5621300-5621322 GTTTTGCAGAAGATGTCCTGTGG - Intergenic
1145966162 17:28919262-28919284 TTTTTGCAGGAGTTGCCGTGTGG - Exonic
1147167377 17:38600795-38600817 CTTTTGGAGCAGAAGTGCTGAGG + Intronic
1147911323 17:43857937-43857959 TTCTTGCAGCAGTAGCCTTGGGG - Intronic
1151593534 17:75062854-75062876 GTTTCGCACCAGAAGCACTGCGG + Intronic
1151672514 17:75579226-75579248 TGATTCCAGCAGAAGCGCTGCGG + Intergenic
1153989982 18:10388018-10388040 TTATTGCATTAGGAGCCCTGTGG + Intergenic
1155349518 18:24892680-24892702 TGTGTGGAGCAGTAGCCCTGTGG + Intergenic
1156347880 18:36274335-36274357 TTTTTGCAGCTGAAGACCCAGGG + Intergenic
1156506556 18:37599490-37599512 TGTTACCAGCAGAGGCCCTGAGG + Intergenic
1157326759 18:46674721-46674743 TGGTTGCAGCAGAAGCACAGAGG + Intronic
1157534942 18:48451240-48451262 TGTTTGCTGCTGAAGCCCAGTGG + Intergenic
1158741885 18:60152442-60152464 TTTTTCCAGAAGTAGCACTGTGG + Intergenic
1159605743 18:70473032-70473054 CTTTGGCATCAGAAGCTCTGGGG - Intergenic
1161246190 19:3253597-3253619 TTCTAGCACCAGAAGCCCAGGGG + Intronic
1162161499 19:8721236-8721258 CTTTTGCATCAGAACCCCTCTGG - Intergenic
1163049453 19:14671072-14671094 ATTTTGGAGAAGAGGCCCTGGGG + Intronic
1165298276 19:34946666-34946688 TTCTTGTATCAGAAGCCCTTGGG + Intergenic
1168107916 19:54175365-54175387 CTTTTGCACCAGAAGCCCTGGGG + Intronic
1168229980 19:55024741-55024763 CTACTGAAGCAGAAGCCCTGGGG + Intronic
1168592240 19:57646954-57646976 TTTTTGCACCAGAAGCCCATGGG - Intergenic
925589315 2:5493909-5493931 GTTTTGCTTAAGAAGCCCTGGGG + Intergenic
926111591 2:10187495-10187517 TGTTTTCAGCAGTGGCCCTGGGG + Intronic
926206883 2:10840260-10840282 TGGTGGCAGCAGATGCCCTGGGG + Intergenic
926246082 2:11123276-11123298 CCTTTGCAGCAGCAGCCTTGTGG - Intergenic
926415633 2:12646837-12646859 TTTTTGCTTCAGAAACCCTGTGG + Intergenic
927515900 2:23671605-23671627 CTTTGGAAGCAGAAGCCCTGAGG + Intronic
928359983 2:30655026-30655048 ATTTTGCAGCCTAGGCCCTGTGG + Intergenic
930641151 2:53855665-53855687 TCTTTGCAGCAGAAGCACTGCGG + Intronic
930980714 2:57523437-57523459 TTCTTGCATCACAGGCCCTGAGG + Intergenic
931214737 2:60230390-60230412 TTGATGGAGCAGAAGCACTGGGG - Intergenic
931867864 2:66431988-66432010 TCTTTGCCGAAGAACCCCTGAGG + Intergenic
932050833 2:68396084-68396106 ATTTTCCAGAAGAGGCCCTGAGG - Exonic
932818439 2:74879905-74879927 TCTTTGCTGGAGCAGCCCTGTGG - Intronic
935352067 2:102159620-102159642 TTTTTCCAGCAAACGCCTTGGGG + Intronic
935460416 2:103325532-103325554 TTTTTCCATCAGCAGCTCTGAGG + Intergenic
936711450 2:115136195-115136217 ATTGTGCAGCAGTAGCCCTGAGG + Intronic
937770461 2:125714709-125714731 TCTTTGCATCAGAATCTCTGGGG + Intergenic
937927348 2:127177316-127177338 TGTCTGCATCAGAAGCCCAGAGG + Intergenic
938578696 2:132627094-132627116 TTTTTCCAGCAGATGTCCTGAGG + Intronic
940101251 2:150041909-150041931 TCTTGGCAGCGGGAGCCCTGGGG - Intergenic
940592208 2:155743821-155743843 ATTTCTCAGCAGAAACCCTGCGG + Intergenic
941585494 2:167352989-167353011 TGTTTAAAACAGAAGCCCTGTGG + Intergenic
942138466 2:172953711-172953733 TTGTTGGAGCTGAATCCCTGAGG + Intronic
943436375 2:187869439-187869461 TTTGTGCAGCTGGAGACCTGGGG - Intergenic
943939432 2:193972871-193972893 TTGTTGTAGCAGAATACCTGAGG + Intergenic
945109343 2:206347690-206347712 TTTTTGCATCCGAAACCCTGGGG + Intergenic
946580106 2:221119177-221119199 TCTTTGCAGAATAAGTCCTGTGG - Intergenic
947329289 2:229011937-229011959 ATCTTGCAGCACAAGCGCTGGGG + Intronic
948213923 2:236214924-236214946 ATTTTGCAGCAGCAGGCCGGGGG - Intronic
948649562 2:239432316-239432338 TTTTTGTTGTAGCAGCCCTGAGG - Intergenic
948909305 2:240995086-240995108 TTTTTGCTGCGGAAGCTCCGGGG + Intergenic
948960348 2:241330250-241330272 TGTTTTCTGCACAAGCCCTGTGG - Intronic
1168930131 20:1615273-1615295 TATTTGCATCAAAGGCCCTGGGG - Intronic
1168934529 20:1652124-1652146 GTTTTGCGTTAGAAGCCCTGGGG - Intronic
1168937635 20:1680251-1680273 TTTCTGCATCAAAAGCCCTGGGG - Intergenic
1168940014 20:1701553-1701575 TTTTTGCATCAAAGGCCCTGGGG - Intergenic
1171474606 20:25398558-25398580 TTTTTGCAGCTGTAGCCTTGAGG + Intergenic
1173992602 20:47314853-47314875 ATTTTGCAGGTGAGGCCCTGAGG - Intronic
1174747655 20:53079839-53079861 TTTTTGCAGAAGAGATCCTGAGG + Intronic
1174997367 20:55585585-55585607 CTTTTGCTAGAGAAGCCCTGTGG - Intergenic
1175665532 20:60855543-60855565 TTTTTGCTGAGGATGCCCTGTGG - Intergenic
1175985710 20:62763304-62763326 TTTTCAGAGCAGAAGCCCTGGGG - Intergenic
1176121309 20:63455728-63455750 TTTTTGCATCTCAAGGCCTGAGG - Intronic
1177121419 21:17141519-17141541 TTTATTCAGCAGAAGTCCTATGG + Intergenic
1177998459 21:28131436-28131458 TTTTTCCATCACAGGCCCTGAGG - Intergenic
1178666642 21:34553139-34553161 TTTTTGTAGCAGCAACTCTGCGG + Intronic
1179493765 21:41758745-41758767 TCCTTGCAACAGAGGCCCTGCGG + Intronic
1179967488 21:44815777-44815799 TGTTTGGAGCAGAGGCACTGTGG - Intronic
1180040866 21:45278974-45278996 ATTTTGCATCAAGAGCCCTGGGG - Intronic
1182065823 22:27431016-27431038 TTTGTGCAGCACAAGATCTGTGG - Intergenic
1183641409 22:39095158-39095180 TTCCTGCAGCAGAGACCCTGTGG - Intergenic
1185212444 22:49577808-49577830 TTTATCCTGCAGATGCCCTGGGG - Intronic
949096981 3:97842-97864 TTTTTGCAGCCGAACCCCACTGG + Intergenic
950755605 3:15169361-15169383 TATTTACAGTAGAAGCCCTAAGG - Intergenic
952428717 3:33201569-33201591 TTTTTGGAGCAGAAGACCTCAGG + Intronic
954129125 3:48550860-48550882 TTACAGCAGAAGAAGCCCTGTGG + Intronic
957648720 3:82970596-82970618 TTTTTCTAGCAGAAGCCAAGAGG + Intergenic
957922391 3:86762556-86762578 TTTTTCCATCAGAAGCCCATGGG - Intergenic
958809270 3:98840960-98840982 TTGCTTCAGCAGAATCCCTGAGG - Intronic
960959829 3:123062438-123062460 ATTTTCCAGCAGCAGCCCCGCGG - Intergenic
961484809 3:127209270-127209292 TTTATGCAGGAGAAGGCCAGAGG + Intergenic
961506776 3:127375326-127375348 TTTTTCCTGCAGGAACCCTGTGG + Intergenic
961800628 3:129446138-129446160 TGTTTGCAGAGGAAGCCTTGAGG - Intronic
962024651 3:131535021-131535043 TTTTTGCATGTGTAGCCCTGAGG - Exonic
963136676 3:141911998-141912020 TCTATGCAGTAGAAGCCCTTGGG + Intronic
963775168 3:149431709-149431731 TTTTTGAAGCAGAAGTCCATTGG + Intergenic
969161358 4:5261838-5261860 TTTTATTAGCAGAAGCACTGAGG + Intronic
970720388 4:18981292-18981314 TTTTTGCAGTAGTAACACTGGGG - Intergenic
972406687 4:38753039-38753061 TGTTTGGAGCAGAAGCCCGTGGG + Intergenic
974365193 4:60938634-60938656 TTTTTGCAGCAGAAGCTAACTGG - Intergenic
974546931 4:63323395-63323417 TGGTTGCAGAAGAATCCCTGAGG + Intergenic
977527779 4:98165807-98165829 TTCTGGCAGCAGACGCCCTTTGG - Intergenic
978513572 4:109547997-109548019 ATTTTGCTGCAGATGCCCTTTGG - Intergenic
980762081 4:137247904-137247926 TTTTTGCAGCTGATACCATGGGG + Intergenic
980830960 4:138128790-138128812 ATCTTGCATAAGAAGCCCTGGGG + Intergenic
981709713 4:147697085-147697107 TATTTTCAGCAAATGCCCTGTGG - Intergenic
982269376 4:153570831-153570853 TGTTCTCAGCAGATGCCCTGAGG + Intronic
982377384 4:154708192-154708214 ACTCTGCTGCAGAAGCCCTGAGG - Intronic
982902569 4:161025629-161025651 TTTTTGCACCAGAAGTCCTTGGG - Intergenic
984009313 4:174351631-174351653 TTCTACCAGGAGAAGCCCTGAGG + Intergenic
984922819 4:184780637-184780659 TCTTTGCAGAAGGAACCCTGCGG - Intronic
985086244 4:186315811-186315833 TTTTACCTCCAGAAGCCCTGCGG + Intergenic
985182922 4:187284761-187284783 TGTTTGAAGCAGAAACCTTGGGG - Intergenic
985561141 5:586671-586693 ACCTTGCAGCAGAAGCCCAGGGG - Intergenic
986029512 5:3881683-3881705 GTTTTGCAGCAGAAGCTGAGGGG - Intergenic
986504819 5:8438888-8438910 TTGTTACAGCAGAATACCTGAGG + Intergenic
986645344 5:9911281-9911303 TTTTTCCAGTAAAAACCCTGTGG - Intergenic
987085193 5:14461352-14461374 TTCTTGCAGCAAAAGCCCAGCGG - Intronic
987310038 5:16673199-16673221 TTTTTCCATAAGAAGCCTTGGGG + Intronic
989273623 5:39560883-39560905 TCTATTCAGCAGAAGCCATGTGG + Intergenic
989345927 5:40429330-40429352 TTTTCACAGCAAAAGCCCTATGG + Intergenic
992518484 5:77522282-77522304 TTTCTGCAGAAAAAGCCTTGAGG + Intronic
993437722 5:87918397-87918419 TTTTAGCAGGAGAAAACCTGAGG + Intergenic
994127900 5:96190293-96190315 ATTCTGCATCAGAAGTCCTGGGG + Intergenic
994179990 5:96753576-96753598 TTTGGTCAGTAGAAGCCCTGTGG + Intronic
995293089 5:110483277-110483299 TTTTTTAAGCAGCTGCCCTGGGG - Intronic
998444293 5:142186820-142186842 TTTTTCCTGCAGGAACCCTGGGG + Intergenic
1001377245 5:171272852-171272874 TTGCTGCAGAAAAAGCCCTGTGG + Intronic
1005267620 6:24128708-24128730 CTTTTGCAGCACTGGCCCTGTGG + Intronic
1007280831 6:40711078-40711100 TTTTTGCAGCAGCATCACTTTGG - Intergenic
1010057187 6:71580061-71580083 TTTTTGGAGCAGAAGCATTCAGG - Intergenic
1010372153 6:75122963-75122985 TATTTGCGACCGAAGCCCTGAGG - Intronic
1010984827 6:82411829-82411851 CTTTTGCTGAAGCAGCCCTGGGG - Intergenic
1011819822 6:91238771-91238793 TTTTTCCAGCAGATGGTCTGAGG - Intergenic
1013544988 6:111147664-111147686 TTTGAGCAGCAGAAGCTCTTAGG - Intronic
1014442716 6:121491935-121491957 TTTGTGCAGCAGAATCACTGAGG + Intergenic
1015343035 6:132123999-132124021 TTTGAACAGCAGAAGCCCTTAGG + Intergenic
1016674066 6:146743008-146743030 TTTCTGCAGCAGAATGCCTTGGG + Intronic
1018601765 6:165551829-165551851 TCTTTGTAGCAGAAGCCCCCTGG + Intronic
1018920610 6:168169833-168169855 ATTTTTCTGCAGAATCCCTGGGG + Intergenic
1019698862 7:2462812-2462834 GTTTTGATGCAGATGCCCTGGGG + Intergenic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1021928026 7:25552084-25552106 TTTATGCAGCAAAAGCCCAGGGG + Intergenic
1022142993 7:27509361-27509383 GTGTAGCAGCAGAAGCCATGAGG + Intergenic
1022479692 7:30734614-30734636 TTTCTGGAGCAGGAGCACTGAGG + Intronic
1025906220 7:65788070-65788092 TTTGTTCAGCTGAAGCCTTGGGG + Intergenic
1026256652 7:68718054-68718076 AGTTTGATGCAGAAGCCCTGAGG + Intergenic
1026502888 7:70957982-70958004 TTATTGCAGCAGCAGCCATGGGG + Intergenic
1026769153 7:73183106-73183128 TTTGTCCAGCGGAAGCCTTGGGG + Intergenic
1026965889 7:74439795-74439817 TTTCTCCATCTGAAGCCCTGTGG - Intergenic
1027010022 7:74736491-74736513 TTTGTCCAGCGGAAGCCTTGGGG + Intronic
1027078019 7:75209546-75209568 TTTGTCCAGCGGAAGCCTTGGGG - Intergenic
1027279970 7:76602004-76602026 TTTATGCAAAGGAAGCCCTGTGG + Intergenic
1029182308 7:98711887-98711909 TCTTTGTACCACAAGCCCTGAGG - Intergenic
1032136464 7:129283733-129283755 TTTTTGTACCACAGGCCCTGAGG + Intronic
1035495246 7:159319772-159319794 TTTTTGCATCTGAAGCCATGTGG + Intergenic
1036262162 8:7249563-7249585 TTCTGGCAGCACCAGCCCTGAGG - Intergenic
1036304426 8:7589995-7590017 TTCTGGCAGCACCAGCCCTGAGG + Intergenic
1036314201 8:7708102-7708124 TTCTGGCAGCACCAGCCCTGAGG - Intergenic
1036355280 8:8037987-8038009 TTCTGGCAGCACCAGCCCTGAGG + Intergenic
1036587967 8:10142406-10142428 ATTTAGAAGCAGAAGCCCTCAGG - Intronic
1038488971 8:27955867-27955889 TTCATGCATCAGAAGCCCTGAGG - Intronic
1038509455 8:28117426-28117448 TGTTTGTAGAAAAAGCCCTGTGG + Intronic
1038678011 8:29641189-29641211 TTTTTGTGGCACAGGCCCTGGGG - Intergenic
1038681046 8:29668489-29668511 TTGTTGCAGCTGGAGCCCTGAGG + Intergenic
1039294149 8:36130959-36130981 TATTTGCAGCTGAAGCCTTTAGG + Intergenic
1039969109 8:42306592-42306614 TTTTGCCACCAGATGCCCTGTGG + Intronic
1040346414 8:46503142-46503164 TTTGTGAAGGAGAAGCCATGGGG - Intergenic
1042296761 8:67227545-67227567 TTTTTGCAGTAGACTCCTTGAGG - Exonic
1042482730 8:69322510-69322532 GTCTTGCAGCTGAAGACCTGGGG + Intergenic
1042482787 8:69322949-69322971 TTTGTGCAGCTGGAGACCTGGGG + Intergenic
1042503192 8:69531966-69531988 GCTCTTCAGCAGAAGCCCTGAGG + Intronic
1043923265 8:86008235-86008257 TTTATGAAGCAGAAACCTTGGGG - Intronic
1045141061 8:99283391-99283413 TTTTTGCACCAAAAGCCCAGTGG - Intronic
1045252415 8:100492916-100492938 TTTTTTCAGGACAAGCCTTGGGG - Intergenic
1045658791 8:104414389-104414411 TTTTTGAGGCAGCAGCTCTGGGG + Intronic
1046243148 8:111525938-111525960 AGTTTCCAGCACAAGCCCTGAGG - Intergenic
1047975454 8:130125596-130125618 TATTTACAACAGAAGCCATGAGG + Intronic
1048202987 8:132392221-132392243 TTTCTCCAGCAGAAACCCTTTGG + Intronic
1048744845 8:137602742-137602764 TAGTTGCAACAGAAGCCCTAAGG + Intergenic
1049475923 8:142796970-142796992 TCCTTGCAGCAGATACCCTGAGG - Intergenic
1049849038 8:144820979-144821001 TTCTTGCCGCAGCAGGCCTGTGG + Intergenic
1050174424 9:2855007-2855029 TTCTGGCAGCTAAAGCCCTGTGG + Intergenic
1052180155 9:25516694-25516716 TTTTTGCAGTGGAAGGCCAGAGG - Intergenic
1053094256 9:35310733-35310755 TTTTTGCAGCACCAGATCTGGGG - Exonic
1056471644 9:86910216-86910238 TGTTTTCAGCAAATGCCCTGGGG - Intergenic
1056534358 9:87515210-87515232 TTGTTGCAACAGAAACCATGTGG - Intronic
1057010917 9:91600597-91600619 ATTTTCCAGCAGAAGCCGAGGGG - Intronic
1057502341 9:95605610-95605632 TTTTACCCGCAGAAGGCCTGAGG + Intergenic
1058871659 9:109207127-109207149 TATTTGGAGGAGAAGCCCTGTGG - Intronic
1059716038 9:116914296-116914318 ATTTTGCAGATGAAGCACTGGGG - Intronic
1061883501 9:133579413-133579435 TTCTTGCAGCAGTAGTACTGCGG + Exonic
1187504586 X:19868611-19868633 TTTATGCAGATGTAGCCCTGTGG - Intronic
1187674689 X:21704083-21704105 TGTTTGGAGCAGAAGCCATTAGG - Intergenic
1188044739 X:25413065-25413087 TTTTTGGAGAAGAGGCCCTCTGG + Intergenic
1190324040 X:49195733-49195755 TTTGTGTAGCAAAGGCCCTGAGG + Intronic
1191811810 X:65197089-65197111 TTGTTGCAGCTGCTGCCCTGTGG - Intergenic
1193798851 X:85911838-85911860 TAAATGCAGCAGAAGCCCTAGGG + Intronic
1194584778 X:95718910-95718932 TTCTTGCATCAGAAGCCCTGGGG - Intergenic
1194827276 X:98578584-98578606 TCTTTTCAGCATAAGCCCTAAGG - Intergenic
1195565551 X:106335202-106335224 TTCTTGCATCAGAAGTCCTTGGG + Intergenic
1195907656 X:109861656-109861678 TTGTTGCAGCAGAATCTTTGAGG + Intergenic
1197326888 X:125105512-125105534 TTTTTGCAGCAGCACCCCTCAGG - Intergenic
1197816994 X:130508188-130508210 TTTTTGCATCTGACTCCCTGTGG + Intergenic
1198481295 X:137043768-137043790 TTTTTGATGCAGATGTCCTGAGG + Intergenic
1198483031 X:137058303-137058325 TTTTTGCACTAGAAGCACTTAGG + Intergenic
1199792790 X:151170584-151170606 TTTTTGCATGAGAAGTCATGAGG + Intergenic
1201280251 Y:12336196-12336218 TATTTGCAGAAGAAGCCTTCAGG + Intergenic
1202032030 Y:20586357-20586379 TTTTTTCTACAAAAGCCCTGTGG + Intronic