ID: 1091404773

View in Genome Browser
Species Human (GRCh38)
Location 12:202368-202390
Sequence CTGTAAACACAGTGAAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 368}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091404768_1091404773 28 Left 1091404768 12:202317-202339 CCTATCACAATTTGTAGTGGTTG 0: 1
1: 1
2: 0
3: 13
4: 93
Right 1091404773 12:202368-202390 CTGTAAACACAGTGAAGGCTGGG 0: 1
1: 0
2: 1
3: 30
4: 368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091404773 Original CRISPR CTGTAAACACAGTGAAGGCT GGG Intronic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
900834242 1:4987969-4987991 CTGTAAACCCAGTGTGGGGTTGG + Intergenic
900888276 1:5430655-5430677 CTGCACACACAGTGAACGCCAGG + Intergenic
901661286 1:10799433-10799455 CTGGAAACAGAGGCAAGGCTGGG + Intergenic
901881240 1:12194997-12195019 CTGTAAACACAATGGAGGCAAGG - Intronic
902053497 1:13582184-13582206 ATTGAAACACAGTGAAGCCTAGG - Intergenic
902172930 1:14627559-14627581 CTGTAAGCTCTGTGAAGGCAGGG + Intronic
902829283 1:18999749-18999771 TTGAAAACCCAGTCAAGGCTGGG + Intergenic
902972276 1:20062496-20062518 CTGAAAACTCAGAGCAGGCTGGG + Intronic
902982004 1:20130776-20130798 CTGTTAAGATAGTGGAGGCTGGG - Intergenic
903300563 1:22375765-22375787 CTGGGAACACAGTGGATGCTCGG + Intergenic
903510831 1:23873873-23873895 CTGGAAATACAGAGGAGGCTGGG - Exonic
904490180 1:30853745-30853767 CTGCTAACAGAGAGAAGGCTAGG - Intergenic
904530684 1:31166808-31166830 CTTAAAACACAGTTAGGGCTGGG + Intergenic
906665879 1:47621689-47621711 CTGTAAACGCTGTGAAGGGAAGG + Intergenic
907404630 1:54246356-54246378 CTGTACACACAGTGGAGAATAGG - Intronic
907622636 1:55996963-55996985 CTCTAAGCACAGGAAAGGCTGGG - Intergenic
908037875 1:60075113-60075135 CTGGAAGCAACGTGAAGGCTAGG - Intergenic
908128965 1:61055523-61055545 ATGTAAACACAGGGAAAGCAAGG - Intronic
908519418 1:64926705-64926727 CTGTAGTGCCAGTGAAGGCTGGG - Intronic
908649348 1:66314706-66314728 ATGAAAACACAGTGGAGGTTGGG - Intronic
909396019 1:75171680-75171702 CTGTTAAGATGGTGAAGGCTGGG + Intergenic
909917471 1:81337595-81337617 ATGAAAACACAGGGAAGACTTGG - Intronic
912386828 1:109274934-109274956 GAGTAAACACAGTGCTGGCTCGG + Exonic
912493233 1:110074191-110074213 GTGTAAGCACTGTGAAGGCAGGG - Intronic
912858288 1:113191372-113191394 ATGTAAACACACTGAAGGAAGGG - Intergenic
913389313 1:118292929-118292951 CTGTAAACTCAGTGATAGCCAGG - Intergenic
914388352 1:147194595-147194617 ATGTAAAGACTGTCAAGGCTAGG - Intronic
914408811 1:147404423-147404445 TTGTAAAGACCGTCAAGGCTAGG + Intergenic
915859692 1:159431043-159431065 CTCTAAACACAATGTAGGCTTGG - Intergenic
916552557 1:165862655-165862677 CTCTAAAGTCAGTGGAGGCTGGG - Intronic
917787708 1:178476784-178476806 CTGAGAACACAGTGAAAGCCAGG - Intronic
917934336 1:179849882-179849904 CTGTAACTTCAGTGAAGGCAAGG - Intronic
918300875 1:183202809-183202831 ATGTAAACTCCGTGAGGGCTGGG + Intronic
918554442 1:185782434-185782456 CTGTAAAGACCATCAAGGCTAGG - Intronic
918854467 1:189732998-189733020 CTGTAGTCACTGTGAAGTCTGGG - Intergenic
919107023 1:193166434-193166456 ATGAAAACACACTTAAGGCTGGG - Intronic
919657268 1:200209530-200209552 GTGTAGAGACAGTGAAGGCTGGG + Intergenic
919720154 1:200825103-200825125 ATATAACCACAGTGAAGGCGGGG - Intronic
919765394 1:201124146-201124168 CTATAGACACAGTGAAGTCATGG + Intronic
920996574 1:210998066-210998088 TTGTAAAGACTGTCAAGGCTAGG + Intronic
921331528 1:214043374-214043396 CTGTGAACAGAGGGAGGGCTGGG - Intergenic
923455046 1:234157551-234157573 CTGAAAACACAGTGCAAGCATGG + Intronic
923772170 1:236947170-236947192 CTGAGCACACAGTGAAGGCCAGG + Intergenic
1062902418 10:1156278-1156300 CTGTATCCCCAGTGCAGGCTAGG + Intergenic
1062912938 10:1225499-1225521 TTGTAAACACCATCAAGGCTAGG - Intronic
1064174974 10:13066909-13066931 ATGTAGACACATTGAAGGGTGGG - Intronic
1065055126 10:21836381-21836403 CTGTAAAGACCATCAAGGCTAGG + Intronic
1065273886 10:24066230-24066252 TTGTAAAGACCGTCAAGGCTAGG - Intronic
1066087412 10:31984521-31984543 CTGTGAAAGCATTGAAGGCTTGG + Intergenic
1066195395 10:33094347-33094369 CTGAAATCACAGTCAAGGCCAGG + Intergenic
1068394696 10:56446169-56446191 TTGTAAAGACAATCAAGGCTAGG - Intergenic
1068828122 10:61462564-61462586 CTTTAGCCACAGTGAAAGCTGGG - Intergenic
1069400992 10:68046557-68046579 CTGTAAACTCATTGAGGGCTAGG - Intronic
1069603959 10:69728359-69728381 CTGTGAAATCAGTGAATGCTTGG + Intergenic
1070121075 10:73577967-73577989 CTGTGAGCAAAGTGGAGGCTTGG - Intronic
1070893221 10:79958204-79958226 ATGTAAAGACCGTCAAGGCTAGG + Intronic
1071994235 10:91131101-91131123 CTGCAAACACACTAGAGGCTGGG + Intergenic
1071998997 10:91175998-91176020 TTGTAAAGACCGTGGAGGCTAGG - Intronic
1073610112 10:104934836-104934858 CTGTGAAAACAGTCAAGGCTGGG + Intronic
1074229722 10:111522020-111522042 CTGCAAACTCCATGAAGGCTGGG + Intergenic
1074342604 10:112648063-112648085 CTTTAAAAACAATGCAGGCTGGG - Intronic
1075236160 10:120731128-120731150 CTGCAAACACAGTGCATGCCAGG - Intergenic
1075490974 10:122868837-122868859 CTGTAAAGACCATCAAGGCTAGG + Intronic
1076938461 10:133582598-133582620 CTGTAAAGACCATCAAGGCTAGG + Intergenic
1077591674 11:3497041-3497063 TTGTAAAGACCGTCAAGGCTAGG - Intergenic
1078674584 11:13398630-13398652 TTGTAAACACCATCAAGGCTAGG - Intronic
1078744902 11:14103305-14103327 GTGTATACCCAGTGAAGGCTGGG + Intronic
1081086981 11:38813234-38813256 CTGTAAAGACCATCAAGGCTAGG + Intergenic
1081405240 11:42690058-42690080 TTGTAAAGACAATCAAGGCTAGG + Intergenic
1081454195 11:43205319-43205341 TTGTAAAGACCGTCAAGGCTAGG - Intergenic
1081484287 11:43515945-43515967 CTGTCAACACAGTGTTGGGTAGG - Intergenic
1082135605 11:48545991-48546013 TTGTAAAGACCGTCAAGGCTAGG - Intergenic
1082240676 11:49866951-49866973 ATGTAAATACCGTCAAGGCTAGG + Intergenic
1082317427 11:50747071-50747093 TTGTAAAGACCATGAAGGCTAGG - Intergenic
1082594381 11:55057631-55057653 CTGTGAACACATTGAGGTCTAGG - Intergenic
1082679104 11:56146680-56146702 CTGTTAACTCAGTGAAAGCCTGG + Intergenic
1083522849 11:63332170-63332192 TTGTAAAGACCGTCAAGGCTAGG - Intronic
1085079462 11:73622078-73622100 CTCAAAACTCAGTGAGGGCTGGG - Intergenic
1085536360 11:77222309-77222331 CTGTAAAGACCGTCAAAGCTAGG - Intronic
1085966839 11:81538376-81538398 TTGTAAAGACTGTCAAGGCTAGG - Intergenic
1086001702 11:81991896-81991918 ATATAAACACAGTGAAGCATGGG + Intergenic
1087168428 11:95026553-95026575 CTGGAAACACAGGCAAGACTTGG + Exonic
1088974932 11:114807245-114807267 CTGTAAAGACCATCAAGGCTAGG + Intergenic
1091404773 12:202368-202390 CTGTAAACACAGTGAAGGCTGGG + Intronic
1092977268 12:13757462-13757484 CGGTAATCACAGTGCATGCTGGG - Intronic
1093047165 12:14460651-14460673 CTGTAAAGAGATTGTAGGCTGGG - Exonic
1093493747 12:19732772-19732794 ATGTAAAGACAGTCAAGACTAGG - Intergenic
1093968963 12:25356958-25356980 CTGTAAACACCCTGACGGGTAGG - Intergenic
1095722284 12:45413679-45413701 GTGTCAACACAGAGAAGGCTTGG + Intronic
1096032860 12:48435812-48435834 TTGTAAACACCATCAAGGCTAGG + Intergenic
1097546274 12:61005173-61005195 TTGTAAACACCATCAAGGCTAGG - Intergenic
1097913533 12:64995824-64995846 CTGAAAACTCACTGAAGGCAGGG - Intergenic
1098017791 12:66124839-66124861 CTGTAAACTCCGTGAGGGCTAGG - Intronic
1099010337 12:77284058-77284080 ATGTAAACACAGTGATGGTGAGG - Intergenic
1101240224 12:102831269-102831291 ATGTAAACACCATCAAGGCTAGG - Intergenic
1101286529 12:103319204-103319226 GAATAAACACAGTGAAGGGTTGG - Intronic
1101422668 12:104562372-104562394 CTGTAAACACAGAGAAGATGAGG + Intronic
1101622257 12:106399888-106399910 TTGTAAAGACTGTCAAGGCTAGG + Intronic
1103103927 12:118205980-118206002 CTGTAACCACAAAGAAGGCTTGG - Intronic
1103327795 12:120133076-120133098 CTGTCCCCACAGAGAAGGCTGGG + Intronic
1105586151 13:21744772-21744794 CTGTATTCAAAGTGAGGGCTAGG - Intergenic
1106018981 13:25897121-25897143 CTGTAAAGACCATCAAGGCTAGG - Intronic
1106192614 13:27466847-27466869 CTGAAAGCACAGCAAAGGCTGGG - Intergenic
1106914224 13:34495007-34495029 ATGTAAAGACCGTCAAGGCTAGG + Intergenic
1107483012 13:40800725-40800747 CTGTGAACAAAGTGAAGGACAGG + Intronic
1108109315 13:47051127-47051149 CTGTAAAAACACTGTAGACTGGG + Intergenic
1109949417 13:69481942-69481964 TTGTAAAGACCGTCAAGGCTAGG - Intergenic
1110290711 13:73803708-73803730 CTGGAGACACAAAGAAGGCTAGG + Intronic
1110891413 13:80703278-80703300 TTGTAAAGACCGTCAAGGCTAGG - Intergenic
1111764932 13:92516619-92516641 CTGTAAAGAAAGAGAAGCCTAGG + Intronic
1112237586 13:97650202-97650224 TTGTAAACTCAGTGAAGGCAGGG - Intergenic
1113488295 13:110671618-110671640 TTGTAAAGACCGTCAAGGCTAGG + Intronic
1113594966 13:111524709-111524731 ATGAAAACAAAGTGATGGCTTGG - Intergenic
1114141179 14:19912517-19912539 TTGTAAAGACCGTCAAGGCTAGG + Intergenic
1115978158 14:39019220-39019242 ATGTAAAGACCGTCAAGGCTAGG + Intergenic
1116657654 14:47673174-47673196 CAGTGGACACAGTAAAGGCTGGG + Intronic
1116704842 14:48283798-48283820 CTGTAAAGACTATCAAGGCTAGG - Intergenic
1116949034 14:50861964-50861986 CTAGAAACACAGGGAAGACTTGG - Intronic
1118521121 14:66586475-66586497 CTGTAAAGACCATCAAGGCTAGG - Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119671309 14:76520750-76520772 CTGTAATCACAGTGCAAGGTGGG + Intergenic
1120838329 14:89061040-89061062 TTTAAAACACAGTGAAGGCCAGG - Intergenic
1121097705 14:91229362-91229384 CTCAAAGCACAGTCAAGGCTAGG - Intergenic
1122883008 14:104698494-104698516 TTATAGACACAGGGAAGGCTCGG + Intronic
1125036148 15:35126297-35126319 TTGTAAACACCTTGAAGGCAGGG + Intergenic
1126629307 15:50717687-50717709 CTAGAAACTCAGTGAAGGTTAGG - Intronic
1127115377 15:55721249-55721271 CTGTAGGCAGAGTGGAGGCTGGG - Intronic
1127290712 15:57568317-57568339 ATGTTAACACAGAGAATGCTTGG - Intergenic
1127974285 15:63985694-63985716 CTGTCAACACAGTGCAGGGCTGG - Intronic
1129138334 15:73574270-73574292 ATGTAAAAACAATGAATGCTTGG + Intronic
1132376181 15:101329785-101329807 ATGGAAACACAGGGAAGCCTGGG - Intronic
1132385720 15:101398577-101398599 CTGAAAGCACAGAGGAGGCTCGG + Intronic
1133539663 16:6737108-6737130 TTGTAAACCCAATGAAGGCAGGG - Intronic
1133539800 16:6738757-6738779 ATGTAAAGACAGTGAAATCTTGG + Intronic
1133854415 16:9536309-9536331 CTGAAATCACAGTGAAAGGTGGG + Intergenic
1133892158 16:9890698-9890720 ATTTAAAGACAGTGAAGTCTGGG - Intronic
1134610287 16:15602804-15602826 CGGTACACACAGTGAACACTGGG + Intronic
1137326216 16:47439739-47439761 CTGTAAAGACCATGAAGGTTAGG + Intronic
1137658424 16:50181598-50181620 TTTTAAATAAAGTGAAGGCTGGG - Intronic
1138077388 16:54056287-54056309 CTGTAAACTCTGTGAGGGCGGGG + Intronic
1140983976 16:80140408-80140430 TTGTAAAGACCGTCAAGGCTAGG - Intergenic
1141241666 16:82270752-82270774 CTGTTGACACAGGGAAGGATAGG - Intergenic
1143317651 17:6044650-6044672 CTGTAAGCACCTTGAAGGCAGGG - Intronic
1143575035 17:7787248-7787270 TTGTAAGCACTGTGTAGGCTTGG + Intronic
1144611910 17:16726908-16726930 CTGGAAACTCCGTGAAGGCAGGG + Intronic
1144900825 17:18588476-18588498 CTGGAAACTCCGTGAAGGCAGGG - Intergenic
1145030857 17:19504155-19504177 GTCCAAACACAGTGGAGGCTGGG + Intronic
1145131627 17:20357260-20357282 CTGGAAACTCCGTGAAGGCAGGG + Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1147642576 17:42013100-42013122 CTATAAAAACATTTAAGGCTGGG - Intronic
1149107616 17:52988267-52988289 ATGTAAACTCAGTGAAGGTGGGG - Intergenic
1149980586 17:61308212-61308234 CTGTAAACTAGCTGAAGGCTTGG - Intronic
1150648210 17:66993001-66993023 CTGTAGACACAGCGCACGCTAGG - Intronic
1151471604 17:74321808-74321830 CTGTGACCACAGTCAAGTCTGGG + Intergenic
1152057732 17:78044450-78044472 CTGTAAACACCATGAAGGCAAGG - Intronic
1152664380 17:81558886-81558908 CTGAAAATAAAGAGAAGGCTGGG + Exonic
1203171716 17_GL000205v2_random:154290-154312 CAGGTAACACAGTGAAGCCTAGG - Intergenic
1154369231 18:13743530-13743552 CTGTAGACACAGGAAAAGCTGGG + Intronic
1158110838 18:53940035-53940057 CTCTAACCACAGGGGAGGCTCGG - Intergenic
1158547732 18:58410313-58410335 CTGTAAACTCAGAGGAGGGTTGG - Intergenic
1158721571 18:59929964-59929986 CAGAAAACACAGTGATTGCTTGG + Intergenic
1158749615 18:60243778-60243800 ATGTAAACTCAGTGAAGGCAGGG + Intergenic
1158976146 18:62713447-62713469 CTGTAAACTCTATGAAGGCAGGG + Intergenic
1161414579 19:4138634-4138656 CTGTAAACTCTGTGAGGGCAGGG - Intergenic
1164683761 19:30153220-30153242 CTGGGAACCCAGTAAAGGCTGGG + Intergenic
1165778561 19:38418958-38418980 CAGTAAGCAAAGGGAAGGCTGGG + Intronic
1166417765 19:42609334-42609356 CTCTAGACACGGTGAAGGGTTGG - Intronic
1168329483 19:55558790-55558812 CTTAAAACACAATGCAGGCTGGG - Intergenic
925383660 2:3446810-3446832 CTGTAAACTCACTGAGGGCGAGG - Intronic
925971959 2:9112284-9112306 CTGTTGACACATTGCAGGCTCGG - Intergenic
927638684 2:24833526-24833548 CTGCAGACACAGGGAAGGCAAGG - Intronic
928036549 2:27829660-27829682 CTGTAAAACCACTGAGGGCTGGG - Intronic
928483760 2:31708851-31708873 AAGGAAACACAGTGGAGGCTGGG + Intergenic
929179498 2:39020172-39020194 TTGTCTACAAAGTGAAGGCTTGG + Intronic
929992347 2:46800938-46800960 CTGCAAAGACAGAGAAGGCCAGG + Intergenic
930054843 2:47244052-47244074 CTGGAAACACTGAGCAGGCTTGG - Intergenic
931088769 2:58863750-58863772 CTGTAAGCACTCTGAAGGCAAGG - Intergenic
931570259 2:63661416-63661438 CTGTAAACTTTTTGAAGGCTAGG + Intronic
931822552 2:65967156-65967178 TTGTAAAGACCGTCAAGGCTAGG - Intergenic
931898514 2:66761345-66761367 CTGTTTTCACAGTGATGGCTGGG + Intergenic
931909732 2:66885593-66885615 TTGTAGAAACAATGAAGGCTAGG - Intergenic
931951855 2:67372840-67372862 CTGTAAAGACCATCAAGGCTAGG + Intergenic
937198229 2:120179519-120179541 GTGCAAACCCAGAGAAGGCTGGG - Intergenic
938672515 2:133599627-133599649 CAGTCCACACAGTCAAGGCTGGG - Intergenic
938969273 2:136417282-136417304 CTGTAGAAAGAGTGATGGCTGGG + Intergenic
939030905 2:137074673-137074695 TTGTAAAGACCGTCAAGGCTAGG - Intronic
939049049 2:137285488-137285510 TTGTAAAGACCATGAAGGCTAGG - Intronic
939066213 2:137486049-137486071 TTGTAAAGACCATGAAGGCTAGG + Intronic
939547691 2:143573635-143573657 CTGTCAATACTGTGAAGGATGGG - Intronic
939685728 2:145197555-145197577 ATGTAAACACTGTGAATGTTAGG - Intergenic
940164336 2:150752676-150752698 CAGAGAACACAGTGAAGCCTTGG - Intergenic
940186810 2:150994319-150994341 CTGTAAAGACAGCAAAGGATTGG - Intergenic
941116883 2:161482030-161482052 CTATAAACTCACTGATGGCTGGG + Intronic
942614463 2:177775901-177775923 CTGTAAGCACTTTGAAGGCAAGG + Intronic
943809112 2:192161874-192161896 CTGTGAACACATTAAATGCTGGG + Intronic
944030068 2:195224690-195224712 CTGTAAAGACCATCAAGGCTAGG + Intergenic
944649775 2:201818199-201818221 CTGTAAACTCATTGAGGGCATGG - Intronic
945244689 2:207707353-207707375 CTGTAATCACAGTGAAAATTTGG + Intergenic
946132956 2:217621877-217621899 CTGTAAATGCAGTGGAAGCTGGG + Intronic
947056448 2:226109294-226109316 TTGTAAAGACCGTCAAGGCTAGG + Intergenic
1169025885 20:2370930-2370952 CTTTAAACACAGGAAAGACTGGG + Intergenic
1170035432 20:11984597-11984619 CAAAAAACACAGTGGAGGCTGGG - Intergenic
1171155902 20:22873669-22873691 TTGTAAAGACCGTCAAGGCTAGG - Intergenic
1171268166 20:23790504-23790526 TTGTAAAGACCGTCAAGGCTAGG + Intergenic
1171786465 20:29470232-29470254 ATGTAAAGACCGTCAAGGCTAGG - Intergenic
1172189675 20:33054337-33054359 CTGTAAACTCCATGAAGGCAGGG - Intergenic
1172928375 20:38562168-38562190 CAGTAAACTCTGTGAAGGCAGGG + Intronic
1173288614 20:41694702-41694724 CTGTAAACACCATGAAGGTAAGG - Intergenic
1173306479 20:41855465-41855487 CTGTAAACTCTGTGAAGGCAGGG + Intergenic
1173386425 20:42592551-42592573 CCCTAAACACAGTGAAGCTTGGG + Intronic
1173661447 20:44737054-44737076 CTGTAAAGACACAGATGGCTGGG + Intergenic
1174677603 20:52373387-52373409 ATGTAAAAATAGTGCAGGCTGGG + Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175047944 20:56125125-56125147 CTGTAAATAGAGTGGATGCTTGG + Intergenic
1175782332 20:61690537-61690559 CAGTAAAGACAGTGAATGCTTGG - Intronic
1177003253 21:15639353-15639375 CTGTAGACAGAGTGCTGGCTGGG - Intergenic
1177514742 21:22134791-22134813 CTTTTAGCACAGTGAAGGGTAGG + Intergenic
1178501722 21:33131232-33131254 CTGTATACACACTGAAGGACAGG - Intergenic
1179240831 21:39590067-39590089 ATCTAAACACATTGAAGCCTGGG + Intronic
1180370870 22:12035447-12035469 TTGTAAAGACCGTCAAGGCTAGG - Intergenic
1181495251 22:23283954-23283976 CTGCAGGCACAGGGAAGGCTGGG - Intronic
1182342499 22:29635132-29635154 CTGCAAACACAGAGAAGGGATGG + Intronic
1183838163 22:40474691-40474713 CTGTAAACTCACTGAAGGTGGGG - Intronic
1184715957 22:46281948-46281970 CTGTAAGGACAGAGAAGTCTGGG - Intronic
1203241003 22_KI270733v1_random:19553-19575 TTGTAATCTCAGTGAAGGCTGGG - Intergenic
949487233 3:4551647-4551669 CTGTAAATATAGTGAGGGTTTGG - Intronic
951061873 3:18218254-18218276 CTGTTAACCCACTGAAGGGTAGG - Intronic
951572790 3:24083037-24083059 TTGTAAAGACCGTCAAGGCTAGG - Intergenic
952238122 3:31501317-31501339 CTGTATGTACAGTGAAGGGTTGG + Intergenic
954107363 3:48416452-48416474 CTGTAGGCACAGGGCAGGCTAGG + Intronic
954512945 3:51143563-51143585 TTAAAAACACAGTGAGGGCTGGG - Intronic
955423365 3:58762625-58762647 TTGTAAAGACCGTCAAGGCTAGG - Intronic
955458999 3:59158965-59158987 CTGTAAATACTGTGATGGATAGG - Intergenic
957513200 3:81216233-81216255 CTGTAACATCAGTGAATGCTCGG + Intergenic
957548735 3:81676235-81676257 CTGTGAACACTGTGGGGGCTAGG - Intronic
958698057 3:97552324-97552346 CTGTAATTAGACTGAAGGCTGGG - Intronic
960919847 3:122734927-122734949 TTGTAAAGACCGTCAAGGCTAGG + Intergenic
962064946 3:131969604-131969626 CTCTCAACACAGTGGAGACTCGG + Intronic
962849153 3:139295004-139295026 CAGTAAACACAGGGAAGCCGGGG - Intronic
962864086 3:139432845-139432867 TTAGAACCACAGTGAAGGCTGGG + Intergenic
962966013 3:140355071-140355093 CTGATAACACAGTGAGAGCTGGG - Intronic
963273303 3:143306528-143306550 CTGTAAGCTCCATGAAGGCTAGG + Intronic
964532922 3:157687245-157687267 TTGTAAAGACCATGAAGGCTAGG + Intergenic
964550723 3:157881395-157881417 TTGTAAAGACCATGAAGGCTAGG + Intergenic
968488254 4:875510-875532 CAGTAAACAAAGGGAAGCCTTGG - Intronic
970022114 4:11581466-11581488 ATGTAAAGACCGTCAAGGCTAGG - Intergenic
970333896 4:15011769-15011791 CTGTAAACAAAGTAATGTCTTGG + Intronic
971802391 4:31308843-31308865 ATGAAAATACAGTTAAGGCTGGG - Intergenic
971837391 4:31786161-31786183 CTGTAAATACAGATAAAGCTTGG - Intergenic
974711284 4:65599171-65599193 CTATAAACACTGTGATGGATTGG + Intronic
974759643 4:66258426-66258448 TTGTAAAAACCGTCAAGGCTAGG + Intergenic
977110108 4:92942657-92942679 TTGTAAAGACCGTCAAGGCTAGG - Intronic
977441116 4:97069584-97069606 CTGTAAATTCTGTGAAGGCAGGG + Intergenic
979344922 4:119575740-119575762 CTGTAAAGACCATCAAGGCTAGG + Intronic
979994962 4:127420684-127420706 CTGAAAATACAGTGCAAGCTTGG + Intergenic
980277331 4:130671082-130671104 CTCTATAAACAGTGAAGCCTAGG + Intergenic
980948235 4:139345385-139345407 CTGTGAACAGAGTCAAGGCTTGG + Intronic
981283920 4:142992933-142992955 CTGTAAAGACCATCAAGGCTAGG + Intergenic
981594128 4:146399991-146400013 CTGTAGACAGAGTAAAGGCCAGG + Intronic
981687364 4:147469890-147469912 TTGTAAAGACCGTCAAGGCTAGG - Intergenic
982336447 4:154244414-154244436 CTCTGAACACGATGAAGGCTAGG + Intronic
982785488 4:159532125-159532147 CTGTAAAGACCATCAAGGCTAGG - Intergenic
984017923 4:174447723-174447745 CTATAATCAAAGTGTAGGCTGGG + Intergenic
986749060 5:10769663-10769685 CTGCAAACACACTGAGGACTAGG - Intergenic
989458132 5:41665835-41665857 CTATAAACACTGTGAAAGGTAGG - Intergenic
989674256 5:43954925-43954947 CTGTAAAGACCATCAAGGCTAGG + Intergenic
989682235 5:44042970-44042992 CTGTAAAGACCATCAAGGCTAGG + Intergenic
989775317 5:45199964-45199986 CTGTGAACACATTGATGGATGGG - Intergenic
989784821 5:45314416-45314438 TTGTAAAGACCGTCAAGGCTAGG + Intronic
990187936 5:53228221-53228243 CTGTAAAGACCATCAAGGCTAGG - Intergenic
990653154 5:57924896-57924918 TTGTAAACACCATCAAGGCTAGG + Intergenic
990678822 5:58217938-58217960 TTGTAAACACCATCAAGGCTAGG + Intergenic
990692075 5:58375666-58375688 TTGTAAACACCATCAAGGCTAGG - Intergenic
991569077 5:68035582-68035604 CTGCAAGCACAGTGACAGCTGGG - Intergenic
992908236 5:81369609-81369631 CTGGAAAGTCAGTGGAGGCTAGG + Intronic
992967196 5:82014915-82014937 TTGTAAAGACCGTCAAGGCTAGG - Intronic
993231228 5:85239582-85239604 CTGTAGACTCAATGAAGACTTGG - Intergenic
993363620 5:87007677-87007699 CTTAAAACACAGTTGAGGCTGGG - Intergenic
994124736 5:96156101-96156123 CAGTAATGACTGTGAAGGCTGGG - Intergenic
994424055 5:99561834-99561856 TTGTAAAGACTGTCAAGGCTAGG - Intergenic
995330043 5:110936019-110936041 TTGTAAAGACCGTCAAGGCTAGG + Intergenic
997915833 5:137924118-137924140 ATGTTACCATAGTGAAGGCTGGG - Intronic
998079264 5:139261148-139261170 CTGTGAAGACAGGGAATGCTTGG - Intronic
998440278 5:142154919-142154941 ATAAGAACACAGTGAAGGCTGGG - Intergenic
999792330 5:154953061-154953083 ATATGAAGACAGTGAAGGCTGGG + Intronic
1000855065 5:166387995-166388017 CTTTAAACAAAGTTGAGGCTGGG + Intergenic
1001504406 5:172265785-172265807 TTGTAAGCACTGTGAAGGCAAGG - Intronic
1002850855 6:995375-995397 CTGGAACTGCAGTGAAGGCTTGG + Intergenic
1003306324 6:4932522-4932544 CTGGCAACACAGGGAAGGCCTGG - Intronic
1003945040 6:11067430-11067452 CTGGAAAGGCAGTGAAGGCAGGG - Intergenic
1004029676 6:11854278-11854300 ATATAAACACAGTGAACCCTTGG - Intergenic
1004295216 6:14403881-14403903 CTGTCAGCTCAGTGAAGGCAGGG + Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005101680 6:22178945-22178967 CTGTAAACACCATCGAGGCTAGG - Intergenic
1005880080 6:30050424-30050446 TTAAAACCACAGTGAAGGCTGGG + Intergenic
1006613546 6:35310145-35310167 CTGGAAACACAGTGACAGATTGG - Intronic
1006692409 6:35900475-35900497 ATGTAAACACAGTGAAGGCAGGG - Intronic
1007078995 6:39085465-39085487 CTGTAGACACCAGGAAGGCTGGG + Intronic
1007764585 6:44153065-44153087 CTGTAAACTCAGGAAAGACTTGG + Intronic
1008406472 6:51123479-51123501 TTGTAAACACCATCAAGGCTAGG + Intergenic
1008491826 6:52095036-52095058 TTGTAAAGACCGTCAAGGCTAGG - Intergenic
1008695947 6:54037177-54037199 ATGTAAACTCTGTGAAGGATTGG + Intronic
1008976706 6:57435437-57435459 CTGTAAGCACAGTTTTGGCTGGG - Intronic
1009503809 6:64449910-64449932 TTGTAAAGACCGTCAAGGCTAGG + Intronic
1009662578 6:66632874-66632896 TTGTAAAGACCGTCAAGGCTAGG + Intergenic
1010614390 6:77995175-77995197 TTGTAAAGACCGTCAAGGCTAGG - Intergenic
1011380079 6:86733248-86733270 TTGTAAAGACCGTCAAGGCTAGG + Intergenic
1014959989 6:127671510-127671532 TTGTAAAGACAATCAAGGCTAGG - Intergenic
1015150322 6:130030197-130030219 CTTTGCACACAGTGAATGCTTGG - Intronic
1015191585 6:130477556-130477578 CTGTAAAGACTGTCAAGGCTAGG + Intergenic
1015197581 6:130540642-130540664 TTGTAAAGACCGTCAAGGCTAGG + Intergenic
1017318114 6:153055982-153056004 CTAAAAACACTGTTAAGGCTAGG + Intronic
1018605613 6:165595100-165595122 CCTTAAACCCAGTGATGGCTGGG - Intronic
1019105792 6:169665750-169665772 CCATAAACACAATGAAGGCTGGG + Intronic
1019107096 6:169677216-169677238 TGGTAAAGACAGTGAAGTCTAGG + Intronic
1020645475 7:10809993-10810015 TTGTAAAGACCGTCAAGGCTAGG - Intergenic
1020736981 7:11963034-11963056 AAGTAAACATAGTGAAGACTGGG - Intergenic
1020751481 7:12146788-12146810 CTGTAAACCGACTGAAGTCTGGG + Intergenic
1021074750 7:16288548-16288570 CTGAAAACACAATACAGGCTGGG + Intronic
1021374321 7:19888051-19888073 CTGTAAAGACCATCAAGGCTAGG - Intergenic
1021737673 7:23655327-23655349 CTGTAAAGACAGTGAAGGAAGGG + Intergenic
1022222157 7:28324055-28324077 CTGTAAACACAGAGAAGCTTTGG + Intronic
1022347481 7:29530465-29530487 CTGTAAAGACTGTCAATGCTAGG + Intergenic
1022406662 7:30096913-30096935 CTGTAAAGACCATTAAGGCTAGG - Intronic
1022657318 7:32331355-32331377 CTGTAAACTCCATGAAGGCAGGG - Intergenic
1023483729 7:40662261-40662283 CTGGTGACACAGTGCAGGCTAGG - Intronic
1023586578 7:41737332-41737354 CTGTGGACAAAGTTAAGGCTGGG - Intergenic
1025737350 7:64162553-64162575 TTGTAAAGACCGTCAAGGCTAGG + Intronic
1026170978 7:67953623-67953645 CTCTAAAGAGAGTGGAGGCTGGG + Intergenic
1027923656 7:84431808-84431830 CTGTAAACTCTTTGAAGGCAGGG - Intronic
1028244893 7:88465282-88465304 CTATAAACTCATTGAAGGCAAGG + Intergenic
1029046385 7:97633740-97633762 CTGTAAACTCTCTGAAGGCAGGG - Intergenic
1030392170 7:108941623-108941645 ATGTAAAGACCGTCAAGGCTAGG - Intergenic
1030457967 7:109797022-109797044 TTGTAAAGACGATGAAGGCTAGG + Intergenic
1030549173 7:110936768-110936790 CTGTTAAAACAGCAAAGGCTTGG + Intronic
1031342538 7:120621387-120621409 CTTTAAACACATTGAAGGATGGG + Intronic
1033484345 7:141774028-141774050 TTGTAAAGACCATGAAGGCTAGG - Intronic
1033624025 7:143090320-143090342 CTGTAAAGACCATCAAGGCTAGG + Intergenic
1034371274 7:150599129-150599151 CTGTAAAGACCATCAAGGCTAGG + Intergenic
1034587393 7:152106994-152107016 CTGTAAACAGCCTGAAGGGTGGG - Intronic
1035624518 8:1060940-1060962 ATATCAACACATTGAAGGCTGGG - Intergenic
1036091004 8:5665163-5665185 CTGTAAACTCAGGGTAGACTTGG + Intergenic
1036211940 8:6849171-6849193 CTGTAAAGACCGTCAAGGCTAGG - Intergenic
1036992627 8:13615615-13615637 CAGCAACCACAGTGTAGGCTGGG - Intergenic
1037183527 8:16034541-16034563 CTGTAAAGACCATCAAGGCTAGG + Intergenic
1037761371 8:21743978-21744000 CTTTAAAGGGAGTGAAGGCTTGG + Intronic
1038124043 8:24651414-24651436 GTGAAAACACAGTGAAAACTTGG + Intergenic
1038896241 8:31785828-31785850 TGGTATACAGAGTGAAGGCTTGG + Intronic
1038915561 8:32017821-32017843 CTGTAAACACAAAAAAGACTAGG - Intronic
1039430240 8:37520050-37520072 CTGGAGATACAGTGATGGCTGGG - Intergenic
1040363885 8:46693835-46693857 CTGTAAAGACCATCAAGGCTAGG + Intergenic
1040369565 8:46756193-46756215 TTGTAAAGACAATCAAGGCTAGG - Intergenic
1041653294 8:60322518-60322540 CTGTAGACAAAGTGTGGGCTTGG + Intergenic
1042205017 8:66319840-66319862 TTGTAAAGACCGTCAAGGCTAGG + Intergenic
1042437490 8:68784185-68784207 CTTTAAACACAGGGAAAGCTTGG - Intronic
1042667757 8:71225196-71225218 TTGAAAGCACAGTGAGGGCTTGG - Intronic
1042786435 8:72551784-72551806 ATATAAACTCAGTGAAGGCAGGG + Intronic
1043177801 8:77043896-77043918 TTGTAAACACCATCAAGGCTAGG + Intergenic
1044587021 8:93877516-93877538 CTGTCAATAGAGTGGAGGCTAGG + Intronic
1045293626 8:100854357-100854379 TTGTAAAGACCGTCAAGGCTAGG + Intergenic
1045393428 8:101737339-101737361 CAGTGAAGACAGTGAAGGCTTGG - Intronic
1046089225 8:109479237-109479259 CTGTATCCAAAGTGAAAGCTAGG - Intronic
1046539513 8:115561257-115561279 CTGAAAACACCGTGAAGGCAAGG + Intronic
1047078964 8:121438055-121438077 CTGTACACACACTGAAGATTGGG - Intergenic
1048030523 8:130627525-130627547 CTGTGACTACACTGAAGGCTAGG + Intergenic
1048613289 8:136047649-136047671 CTGTAAACACCTTGAAGGCAGGG + Intergenic
1049930851 9:455158-455180 GTGTAAGAACAGTGAAGTCTGGG - Intronic
1050069671 9:1797615-1797637 CTGTAATAACAGAGAAGGCAAGG + Intergenic
1051046272 9:12878255-12878277 CTGTATCTACAGTGAAGGCTGGG + Intergenic
1052455382 9:28690278-28690300 CTGTAATCAGAGTGTGGGCTGGG - Intergenic
1055256695 9:74380110-74380132 TTGTAAACACATTGAATGGTGGG + Intergenic
1055899614 9:81219200-81219222 CTGTAAAGACCATCAAGGCTAGG + Intergenic
1056887245 9:90455286-90455308 AAGAAAACACAGTGAAGGCCAGG - Intergenic
1058460621 9:105179073-105179095 GTGGAAACAAAGTGAAGCCTGGG + Intergenic
1058747532 9:108006766-108006788 CTGTAAACACAGAGAAATCAAGG - Intergenic
1059486889 9:114633957-114633979 CTGCAAACACTGTGTAGGCTGGG - Intronic
1203447272 Un_GL000219v1:69450-69472 TTGTAAAGACCGTCAAGGCTAGG - Intergenic
1186507308 X:10103375-10103397 CTGTAGACAGATGGAAGGCTAGG + Intronic
1186920221 X:14270393-14270415 CTGTAAACACCCAGAAGGCAGGG + Intergenic
1187923871 X:24232723-24232745 TTAAAAACACAGTGCAGGCTGGG - Intergenic
1188940628 X:36233702-36233724 TTGTAAAGACCGTCAAGGCTAGG - Intronic
1189234753 X:39478358-39478380 CTGTAAACACAGTAAATGTAAGG + Intergenic
1189919000 X:45885147-45885169 CTGTAAACATAAAGCAGGCTGGG + Intergenic
1189994847 X:46628558-46628580 CTATAAACAGAGTCATGGCTAGG - Intronic
1190818215 X:53947967-53947989 CTGGAAAAACTTTGAAGGCTGGG - Intronic
1191012250 X:55772984-55773006 CTGTAAAGACCATCAAGGCTAGG - Intergenic
1191203409 X:57809121-57809143 TTGTAAACACCATCAAGGCTAGG - Intergenic
1191266309 X:58397682-58397704 ATGTAAAGACCATGAAGGCTAGG + Intergenic
1191745490 X:64482456-64482478 TTGTAAAGACTGTCAAGGCTAGG - Intergenic
1191814322 X:65226425-65226447 TTGTAAAGACCGTCAAGGCTAGG + Intergenic
1191990358 X:67028221-67028243 TTGTAAACACCATCAAGGCTAGG + Intergenic
1192181924 X:68921572-68921594 CTGTGAGCTCAGTGAAGGCGAGG + Intergenic
1192910610 X:75600586-75600608 TTGTAAAGACAGTCGAGGCTAGG - Intergenic
1196201423 X:112890093-112890115 CAGTAACCCCACTGAAGGCTTGG + Intergenic
1198239813 X:134773355-134773377 CTGTAAATTCAATGAGGGCTGGG - Intronic
1198372908 X:136008593-136008615 CTGTAATCACAGTGAATGTGTGG - Intronic
1199089520 X:143675202-143675224 CTGTAAACTCTGTGAAGGCAAGG + Intergenic
1201013258 Y:9571895-9571917 TTGTAAAGACCGTCAAGGCTAGG - Intergenic