ID: 1091405957

View in Genome Browser
Species Human (GRCh38)
Location 12:209744-209766
Sequence TCACTTTGAGGTAGGCATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 330}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091405957_1091405963 10 Left 1091405957 12:209744-209766 CCACCATGCCTACCTCAAAGTGA 0: 1
1: 0
2: 2
3: 38
4: 330
Right 1091405963 12:209777-209799 TCCGTTTTTGTAGCAGAGATAGG 0: 1
1: 0
2: 2
3: 126
4: 5699
1091405957_1091405965 11 Left 1091405957 12:209744-209766 CCACCATGCCTACCTCAAAGTGA 0: 1
1: 0
2: 2
3: 38
4: 330
Right 1091405965 12:209778-209800 CCGTTTTTGTAGCAGAGATAGGG 0: 1
1: 1
2: 1
3: 19
4: 596

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091405957 Original CRISPR TCACTTTGAGGTAGGCATGG TGG (reversed) Intronic