ID: 1091405957 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:209744-209766 |
| Sequence | TCACTTTGAGGTAGGCATGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 371 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 38, 4: 330} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1091405957_1091405965 | 11 | Left | 1091405957 | 12:209744-209766 | CCACCATGCCTACCTCAAAGTGA | 0: 1 1: 0 2: 2 3: 38 4: 330 |
||
| Right | 1091405965 | 12:209778-209800 | CCGTTTTTGTAGCAGAGATAGGG | 0: 1 1: 1 2: 1 3: 19 4: 596 |
||||
| 1091405957_1091405963 | 10 | Left | 1091405957 | 12:209744-209766 | CCACCATGCCTACCTCAAAGTGA | 0: 1 1: 0 2: 2 3: 38 4: 330 |
||
| Right | 1091405963 | 12:209777-209799 | TCCGTTTTTGTAGCAGAGATAGG | 0: 1 1: 0 2: 2 3: 126 4: 5699 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1091405957 | Original CRISPR | TCACTTTGAGGTAGGCATGG TGG (reversed) | Intronic | ||