ID: 1091405963

View in Genome Browser
Species Human (GRCh38)
Location 12:209777-209799
Sequence TCCGTTTTTGTAGCAGAGAT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5828
Summary {0: 1, 1: 0, 2: 2, 3: 126, 4: 5699}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091405958_1091405963 7 Left 1091405958 12:209747-209769 CCATGCCTACCTCAAAGTGAACT 0: 1
1: 0
2: 0
3: 16
4: 185
Right 1091405963 12:209777-209799 TCCGTTTTTGTAGCAGAGATAGG 0: 1
1: 0
2: 2
3: 126
4: 5699
1091405959_1091405963 2 Left 1091405959 12:209752-209774 CCTACCTCAAAGTGAACTCACCA 0: 1
1: 0
2: 2
3: 14
4: 140
Right 1091405963 12:209777-209799 TCCGTTTTTGTAGCAGAGATAGG 0: 1
1: 0
2: 2
3: 126
4: 5699
1091405956_1091405963 11 Left 1091405956 12:209743-209765 CCCACCATGCCTACCTCAAAGTG 0: 1
1: 0
2: 1
3: 18
4: 181
Right 1091405963 12:209777-209799 TCCGTTTTTGTAGCAGAGATAGG 0: 1
1: 0
2: 2
3: 126
4: 5699
1091405960_1091405963 -2 Left 1091405960 12:209756-209778 CCTCAAAGTGAACTCACCACCTC 0: 1
1: 0
2: 2
3: 32
4: 233
Right 1091405963 12:209777-209799 TCCGTTTTTGTAGCAGAGATAGG 0: 1
1: 0
2: 2
3: 126
4: 5699
1091405957_1091405963 10 Left 1091405957 12:209744-209766 CCACCATGCCTACCTCAAAGTGA 0: 1
1: 0
2: 2
3: 38
4: 330
Right 1091405963 12:209777-209799 TCCGTTTTTGTAGCAGAGATAGG 0: 1
1: 0
2: 2
3: 126
4: 5699
1091405954_1091405963 27 Left 1091405954 12:209727-209749 CCAGCACACAGCTCTCCCCACCA 0: 1
1: 0
2: 5
3: 63
4: 437
Right 1091405963 12:209777-209799 TCCGTTTTTGTAGCAGAGATAGG 0: 1
1: 0
2: 2
3: 126
4: 5699
1091405955_1091405963 12 Left 1091405955 12:209742-209764 CCCCACCATGCCTACCTCAAAGT 0: 1
1: 0
2: 0
3: 18
4: 224
Right 1091405963 12:209777-209799 TCCGTTTTTGTAGCAGAGATAGG 0: 1
1: 0
2: 2
3: 126
4: 5699

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091405963 Original CRISPR TCCGTTTTTGTAGCAGAGAT AGG Exonic