ID: 1091406030

View in Genome Browser
Species Human (GRCh38)
Location 12:210075-210097
Sequence AGGGCTGGCGGGAGCATGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 215}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091406030 Original CRISPR AGGGCTGGCGGGAGCATGTC GGG (reversed) Intronic
900717469 1:4154108-4154130 AGGGCTGGAGGCATCATCTCAGG + Intergenic
903132625 1:21289849-21289871 AGGGATGGCGGGGGCAGGTGAGG + Intronic
903285609 1:22275027-22275049 AGGGTAGGCGAGAGCAGGTCTGG + Intergenic
905865971 1:41377029-41377051 GGGGCAGGCGGGACCATGCCTGG + Intronic
906057258 1:42927000-42927022 AGGGCTGCTGGGAGCAGGCCGGG + Exonic
906165332 1:43681703-43681725 AGTGATGGCGGGGGCAGGTCGGG + Intronic
906657930 1:47562102-47562124 TGGGCTGGCTGGTGCATGTGGGG + Intergenic
915785602 1:158607743-158607765 AGGGCTGGCTGGAGCCCATCAGG + Intergenic
916186147 1:162135281-162135303 AGGACTGGCTGGGTCATGTCAGG + Intronic
917713527 1:177711091-177711113 GGGGCTGGCGGGAGCGGGACTGG + Intergenic
919784413 1:201250350-201250372 GGGGCTGGCAGGAGAATGTGAGG + Intergenic
923470446 1:234285773-234285795 AGGGGTAGCGGGAGAATGTGTGG + Intronic
924728249 1:246689814-246689836 AGGGCTGGCGGGCGCCGGGCTGG - Intergenic
924953454 1:248906468-248906490 TGGGCTGGCGGGACCAGGACAGG + Intronic
1062939842 10:1412983-1413005 AGGGCTGGCGGGAGGGTGGATGG + Intronic
1063105466 10:2988060-2988082 AGGGCTGGAGGCAGCATCCCTGG + Intergenic
1063972746 10:11392904-11392926 AGAGCTGGAGGGGGCATGGCGGG + Intergenic
1064703479 10:18046463-18046485 AGGGCTGGTGGGAGCTGGTTTGG - Intergenic
1064861042 10:19825911-19825933 ATAGCTGGCGGGAGCAAGTCTGG + Intronic
1067214091 10:44286107-44286129 AGGGCTGGGGGGAGTAGCTCTGG - Intergenic
1071801416 10:89066315-89066337 AGGGCTGGAGGGAGCCTGGGGGG - Intergenic
1071882125 10:89910993-89911015 AGTGGTGGCGGTAGCATGGCTGG + Intergenic
1072979311 10:100086562-100086584 AGGGCTGGCTGGAGGATCTGCGG + Intergenic
1073084477 10:100879430-100879452 AGGGGTGGGGGGTGCATGGCAGG + Intergenic
1073290064 10:102409120-102409142 AGGGCGGACGGGGGCATGGCCGG - Intronic
1073476458 10:103756890-103756912 GGGGCTGGCGGGAGCTTGCACGG - Intronic
1075021083 10:118952952-118952974 AGGGCTGGCTGGTGCCTGGCAGG - Intergenic
1075351195 10:121726504-121726526 AGGGCTGGGGGGCCCATGCCAGG + Intergenic
1075427535 10:122353442-122353464 AGGGGTGATGGGAGGATGTCTGG - Intergenic
1075709666 10:124523888-124523910 AGGGCTGCTGAGAGGATGTCTGG - Intronic
1075961219 10:126568947-126568969 CGGGCTGGCAGGAGGAGGTCTGG + Intronic
1076512757 10:131024058-131024080 AGGGCTGCAGGGAGCATGGTGGG + Intergenic
1076888038 10:133271492-133271514 AGTGCTGACGGGAGCAGGTATGG + Intronic
1077136351 11:1001253-1001275 AGGGCTGGGGAGAGCACGTGCGG - Intronic
1078160333 11:8834627-8834649 AGGGCTTCCGGGAGCAGGTCAGG - Intronic
1078555152 11:12319161-12319183 AGAGCTGGCGTCAGAATGTCTGG - Intronic
1080418160 11:32088866-32088888 CTGGCTGGGGGAAGCATGTCTGG + Intronic
1080699409 11:34631709-34631731 AGGGCTGGATGTAGGATGTCTGG + Intronic
1085510733 11:77086808-77086830 AGGCCTGGCGGGAGCAGGCTGGG + Intronic
1085518460 11:77124671-77124693 AGTGCTGGAAGGAGCATGCCTGG + Exonic
1086700622 11:89896966-89896988 AGGGCTGCCCGGAGCATGCCAGG + Intergenic
1086705547 11:89947560-89947582 AGGGCTGCCCGGAGCATGCCAGG - Intergenic
1088830091 11:113529591-113529613 AGGGCTTGATGGAGCAGGTCTGG - Intergenic
1089789831 11:120934604-120934626 AGGGCAGGCGGGAGCCAGCCTGG - Intronic
1090269049 11:125373058-125373080 AGGGCTGTCAGGATCATGCCGGG - Intronic
1091406030 12:210075-210097 AGGGCTGGCGGGAGCATGTCGGG - Intronic
1092424151 12:8360323-8360345 AGGGCTGGTAGGAGCATGAGAGG - Intergenic
1094357678 12:29595642-29595664 AGGGCTGGATGGAGCAGTTCAGG + Intronic
1098111508 12:67126808-67126830 AGAGCTGGAAGGAGCATGCCTGG - Intergenic
1102240657 12:111322584-111322606 AGTGCGGGCAGGAGCATCTCAGG + Intronic
1103332123 12:120161632-120161654 ATGGCTGGCGGGAGGCTGACAGG - Intronic
1103381270 12:120496050-120496072 GGGGCCGGCGGGAGCAGGGCGGG + Intronic
1103916076 12:124376373-124376395 AGGCTTGGTGGGAGCATTTCAGG - Intronic
1103954597 12:124569005-124569027 GGGGCTGGCGGGAGCCTCTGGGG + Intergenic
1104114142 12:125732781-125732803 TGGGCTGGATGGAGGATGTCTGG + Intergenic
1104483035 12:129125051-129125073 AAGGCTGGAGGGGGGATGTCTGG + Intronic
1104843049 12:131833804-131833826 CTGGCTGGCGGGTGCATGTGTGG - Intronic
1107067544 13:36231525-36231547 AAGGCTGGAAGCAGCATGTCAGG + Intronic
1107726684 13:43306292-43306314 AGGCCAGGCAGGAGCATCTCAGG + Intronic
1110342896 13:74413728-74413750 AGGGTTGACGGCAGCTTGTCGGG + Intergenic
1112316681 13:98369271-98369293 AGAGCTGGCAGGAACATGTGTGG + Intronic
1113465228 13:110507933-110507955 AGGGCTGGCGGGCTCCTGCCTGG + Exonic
1118817442 14:69323361-69323383 AGGGCTGGAGGGAGCCGGTGGGG + Intronic
1119072182 14:71597752-71597774 AGGACAGGCAGGAGCCTGTCAGG - Intronic
1121857553 14:97283953-97283975 TGGGCTGGAGGCAGCATGTCAGG - Intergenic
1122266872 14:100550713-100550735 AGGGCTGGCAGGTGCAAGGCTGG - Intronic
1122831483 14:104399426-104399448 AGGGGTGGCGGGAGCAGCGCAGG - Intergenic
1122984904 14:105207546-105207568 AGGGCTGGGGTGTGCATGCCTGG + Intergenic
1124249388 15:28097109-28097131 AGGGCGGCGGGGAGCAGGTCCGG - Intronic
1124361013 15:29036468-29036490 AGGGGTGGTGGGAGCAGCTCTGG + Intronic
1125589228 15:40844225-40844247 GGAGCGGGCTGGAGCATGTCCGG + Intronic
1128301615 15:66569706-66569728 AGGGCTGGAGGGAACCTGCCGGG + Intergenic
1128422442 15:67506424-67506446 AGGGCTGGGAGGAGCCTGGCTGG + Intergenic
1128479855 15:68027879-68027901 AGGGATGGCTGGAGAATCTCAGG - Intergenic
1129266203 15:74394616-74394638 AGGGCAGGAGGCAGCATGACGGG - Intergenic
1129409147 15:75339223-75339245 AGCTCTGGAGGTAGCATGTCGGG - Intronic
1130021929 15:80239123-80239145 AGGGCTGGCGTGAGTAGGTGTGG - Intergenic
1132322882 15:100939371-100939393 AGGGAAGGTGGGAACATGTCAGG - Intronic
1132630386 16:914486-914508 AGGGAGGGAGGGAGCGTGTCTGG - Intronic
1132712213 16:1274087-1274109 ACGGGTGGCGGGAGCAGCTCAGG + Intergenic
1132903780 16:2271946-2271968 AGGGCTGGAGGCTGCCTGTCAGG - Intergenic
1134551555 16:15141157-15141179 AGGGCTGGCTGGAGGCTGGCAGG - Intergenic
1134687688 16:16170019-16170041 AAGGCTGGCTGGGGCCTGTCGGG - Intronic
1134871412 16:17655466-17655488 AGGGATGGGAGGAGCATTTCTGG - Intergenic
1135838564 16:25851708-25851730 GGGGCAGGCGGGGGCATGTCAGG + Intronic
1137370076 16:47896991-47897013 AGGGCTGGCGGAAGCAGGGTGGG + Intergenic
1139726900 16:68907490-68907512 AGGGCCGGGTGGAGCATCTCGGG + Exonic
1141170233 16:81686336-81686358 AGGCCTGTCGTGTGCATGTCAGG - Intronic
1141596455 16:85099986-85100008 AGGGGTGGTGGGAGCATGGAGGG - Intronic
1142066839 16:88067689-88067711 AGGGGTGGCCAGAGCATGGCAGG - Intronic
1142284896 16:89167677-89167699 AGGGCTGGCGGGGTCAGGGCTGG - Intergenic
1142305311 16:89281196-89281218 AGGCCTGGCAGGAGCCTGGCTGG + Exonic
1142597184 17:1035484-1035506 AGGGGTGGGGGGAGCAGGTGTGG - Intronic
1142597208 17:1035543-1035565 AGGGGTGGGGGGAGCAGGTGGGG - Intronic
1142597224 17:1035574-1035596 AGGGGTGGGGGGAGCAGGTGTGG - Intronic
1142597238 17:1035605-1035627 AGGGGTGGGGGGAGCAGGTGTGG - Intronic
1142886031 17:2912499-2912521 AGGGTTGACGGGAGCCTTTCTGG + Intronic
1142967220 17:3589156-3589178 ATGGCAGGCAGGAGCATGGCAGG - Intronic
1143030690 17:3965312-3965334 AGGGCTGGGGTGAGGCTGTCTGG - Intergenic
1147250717 17:39151337-39151359 AGGACTGGCGGGAGCCGGCCCGG - Intronic
1147621349 17:41869941-41869963 AGAGCTGGCGGGGGCATGGCTGG - Intronic
1147791679 17:43017803-43017825 AGGGATGGAGAGAGCATGTGAGG - Intronic
1151357801 17:73570828-73570850 AGGCCTGGGAGGAGCATTTCGGG - Intronic
1151581554 17:74982146-74982168 AGCGCTGGAGCGAACATGTCCGG + Intergenic
1151658561 17:75507077-75507099 AGGGCCGGCTGGAGCCTGTGAGG - Exonic
1151682632 17:75629887-75629909 AGGGCTAGGTGGGGCATGTCAGG - Intronic
1151930739 17:77230109-77230131 GGGGCGGGCAGGAGCATGTAGGG - Intergenic
1152305984 17:79520365-79520387 AGGACTAGAAGGAGCATGTCGGG + Intergenic
1152325803 17:79635227-79635249 AGGGCTGGAGGGGGCATGGAAGG + Intergenic
1152338279 17:79710043-79710065 GGGGCTGGTGGGTGAATGTCAGG - Intergenic
1153454222 18:5262284-5262306 AGGGCTGGCCAGTGCAGGTCTGG - Intergenic
1153786121 18:8537065-8537087 GGGGCTGCCAGGAGCATGGCAGG + Intergenic
1157518066 18:48325017-48325039 AGGGCTGTGGGGACTATGTCGGG + Intronic
1157814815 18:50722860-50722882 AGGGTTCTCAGGAGCATGTCTGG - Intronic
1160609914 18:80076923-80076945 AGGGCTGGCGGGAACTAGGCAGG - Intronic
1160863476 19:1247577-1247599 ACGGCTGCCGGGAGCATGGGTGG + Intergenic
1160969720 19:1762228-1762250 AGGGCTGGCGGGCGCAGCTGGGG - Intronic
1161323395 19:3651710-3651732 AGGGCTGGCGAGGGCATGCGTGG - Intronic
1162028886 19:7909039-7909061 GGGGCTGGCGGGACCAGGTGGGG - Intronic
1164443001 19:28293505-28293527 GGGGCTGGCAGGGGCAAGTCAGG + Intergenic
1164575147 19:29401545-29401567 AGGGGCGGTGGGGGCATGTCTGG - Intergenic
1166267227 19:41691799-41691821 AGGGCCGGCTGGAGCATGTGTGG + Intronic
924997195 2:373025-373047 ACGGCAGGAGGGGGCATGTCAGG - Intergenic
925975134 2:9137111-9137133 AGGGCTGGAGGGTGCATGGGTGG + Intergenic
928659666 2:33489146-33489168 AGGGCTGTCGTGAGCATTTTGGG - Intronic
930058467 2:47269916-47269938 AGGGCTGGCTGGAGTGTGTGTGG - Intergenic
934580697 2:95435345-95435367 ATGGCTGCCAGGAGCATGCCAGG - Intergenic
934598754 2:95641372-95641394 ATGGCTGCCAGGAGCATGCCAGG + Intergenic
935673693 2:105576307-105576329 AGGGCTGGAGGGAGCGGGTGGGG + Intergenic
935836193 2:107056846-107056868 TGGGATGGCGGGAGCATTTTTGG + Intergenic
938716441 2:134026702-134026724 GGTGCTGGAGGGAGCATGACTGG - Intergenic
941030002 2:160500132-160500154 AGGGCTGGAGGGAGCTAGTTTGG + Intergenic
948963283 2:241356507-241356529 AGGCCGGGCGGGACCATCTCTGG - Intronic
949038742 2:241834637-241834659 AGGGCTGGAGGGACCAGGGCAGG - Intergenic
949069130 2:242013032-242013054 AGGGATGACGGCTGCATGTCGGG + Intergenic
1169211459 20:3768127-3768149 AGGGCTGTCGGGCGCGTCTCGGG + Intronic
1172105897 20:32517232-32517254 AGGGCTGCTGGGAGAATGCCTGG - Intronic
1173428137 20:42960384-42960406 AGGGCTAGAGGGAGCTTGTTAGG - Intronic
1175941428 20:62539136-62539158 GTGCCTGGCGGGAGCATTTCTGG + Intergenic
1176172338 20:63701637-63701659 AGGGCTGGCAGCAGCAGGTCTGG + Intronic
1176218530 20:63959324-63959346 AGGGCAGGCCGGAGCCTGTCAGG + Exonic
1176364605 21:6025295-6025317 AGGGCTGGCAGAAGCCTGTGTGG + Intergenic
1176366849 21:6038364-6038386 AGGGGTGGGGGGTGCATGTGTGG + Intergenic
1176430947 21:6575275-6575297 AGGCCTGGCTGAAGCATGGCCGG + Intergenic
1179706341 21:43182737-43182759 AGGCCTGGCTGAAGCATGGCCGG + Intergenic
1179756669 21:43500180-43500202 AGGGGTGGGGGGTGCATGTGTGG - Intergenic
1179758913 21:43513250-43513272 AGGGCTGGCAGAAGCCTGTGTGG - Intergenic
1179935555 21:44601674-44601696 AGGCCGGGCGGGAGCATGCGGGG - Exonic
1179939302 21:44627927-44627949 TGGGCTGGCGGGAGGAGGTGGGG - Exonic
1179948741 21:44697912-44697934 AGGCCAGGCGGGAACATGTGGGG - Exonic
1180180345 21:46116104-46116126 TGGGCTGGGGGGAGCCTGCCTGG - Intronic
1180181810 21:46121471-46121493 AGGGCTGGACGGGGCATGTCAGG + Intronic
1183501294 22:38181209-38181231 GGGGAAGGAGGGAGCATGTCGGG + Intronic
1184721388 22:46316112-46316134 AGAGCTGGCCGCAGCATGGCGGG - Exonic
950289335 3:11770976-11770998 AGGGCTGCGGAGAGCAGGTCTGG - Intergenic
950435935 3:12980146-12980168 AGGGGTGGTGGGAGCATTACAGG - Intronic
950657208 3:14443998-14444020 GGGGTTGGCAGGAGCATGGCAGG - Intronic
951437705 3:22684235-22684257 ATGGCTGCCTGGAGAATGTCAGG + Intergenic
954408538 3:50359030-50359052 AGTGCTGGCGGGCGCCTGGCAGG + Exonic
954635890 3:52070634-52070656 AGGGCTGGCGTCAGTATGTGTGG + Intergenic
956417885 3:69052216-69052238 CGGGCTCGCGGGAGGCTGTCGGG - Exonic
958426167 3:93980461-93980483 AGCGGTGGCGGGAGCCTGTCAGG + Exonic
961450300 3:126999555-126999577 GGGGGTGCCGGGAGGATGTCTGG - Intronic
966542314 3:181105807-181105829 AGGGGTGGGGGGAGGTTGTCGGG - Intergenic
966845838 3:184129044-184129066 AGGGCTGGTCTGTGCATGTCTGG + Intergenic
968550994 4:1223299-1223321 AGGGCTGGCTGGAGCCTGTGAGG - Intronic
968656117 4:1779149-1779171 GGGGCTGGCGGGACCCTGTCTGG - Intergenic
968918753 4:3511583-3511605 AAGGCTAGAGGCAGCATGTCGGG - Exonic
969139411 4:5055545-5055567 AGGGCTGGAGGGAGGATTTGAGG - Intronic
969338678 4:6527293-6527315 AGGACTGGAGGCAGCTTGTCCGG - Intronic
969800709 4:9562659-9562681 AGGGCTGGTAGGAGCATGGGAGG + Intergenic
971473566 4:27051702-27051724 ATGGCTGGAGGGAGCAGGACGGG + Intergenic
973132907 4:46670851-46670873 AGGACTGGGTGGAGCATTTCAGG + Intergenic
973873021 4:55185751-55185773 AGGGCTGGGGGGAGCAGATCTGG - Intergenic
982807454 4:159784061-159784083 AGGGCTGGAATGAGCATGTCAGG + Intergenic
983939817 4:173527298-173527320 CGGGCTGGCCGCAGCACGTCTGG - Exonic
985484038 5:139094-139116 AGGGCTGGCAGGGGCAAGTGTGG + Intergenic
985631344 5:1015685-1015707 AATGCTGGCGGCAGCATGTGCGG - Intronic
985966692 5:3343280-3343302 GGGGCTGGAGGGAGCAGATCAGG + Intergenic
986174187 5:5337801-5337823 AGGGAAGGCTGGAGCATTTCAGG + Intergenic
1001539091 5:172524616-172524638 AGGGCTGTCTGGAGTTTGTCAGG - Intergenic
1002033389 5:176447447-176447469 AGGGGCGGCGGCAGCACGTCAGG + Intergenic
1002067271 5:176658100-176658122 GGGACTGGCGGGAGCCTGTTTGG + Exonic
1002466427 5:179411085-179411107 AGGGCTGGGGGGAAGCTGTCAGG - Intergenic
1002564716 5:180104322-180104344 AGGGCTGGAGGGAGCCAGTCTGG + Intronic
1002912181 6:1498701-1498723 TGGGCTGGAGGGAGCATCTGGGG - Intergenic
1003145782 6:3509275-3509297 AGGGCTGGAGGGAGCAAGCTGGG + Intergenic
1004078124 6:12364053-12364075 AGGCCTTGCTGGAGAATGTCTGG + Intergenic
1004324534 6:14662728-14662750 AGGGGTGATGGGAGCATGTTGGG + Intergenic
1006081984 6:31573054-31573076 AGAGCTGGTGGGGACATGTCTGG - Intronic
1006386424 6:33733562-33733584 AGGGGTGGCAGGATCATGTGTGG - Intronic
1006457970 6:34142882-34142904 AGGGGAGGCGGGAGCATGTCAGG - Intronic
1007269148 6:40622799-40622821 AGGCCTGGCATGAGTATGTCAGG + Intergenic
1012988940 6:105904951-105904973 ACGGGTGGCTGGAGCCTGTCTGG - Intergenic
1014543331 6:122701882-122701904 AGGGCATGCAGGAGCATGTGAGG + Intronic
1019361579 7:607621-607643 AGGGCTGGCGGTGCCATCTCTGG - Intronic
1019631267 7:2051144-2051166 AGGGCTGGAGGGACCAGGCCCGG - Intronic
1020660412 7:10974381-10974403 AGGGCCGGTGGGAGCAGGGCAGG + Intronic
1024007891 7:45241031-45241053 AGGGCTGGGGTGAGCCTGACAGG + Intergenic
1026578110 7:71591403-71591425 AGGGCTGCAGGGAGCAATTCGGG - Intronic
1027442332 7:78232712-78232734 AGGGCTGGTGGGAAAATGTGAGG + Intronic
1029655682 7:101922851-101922873 TGGGCTGGCCACAGCATGTCAGG + Intronic
1031992255 7:128206207-128206229 AGGGCAGCGGGGAGCATGGCAGG - Intergenic
1032016182 7:128381683-128381705 AGGGCTGGCAGAAGCATGGAAGG + Intergenic
1034125921 7:148671550-148671572 AGGGCTGGAGGGAGCATTTGAGG - Intergenic
1037916477 8:22776166-22776188 AGCGCTGGCGTCAGCATTTCAGG - Intronic
1038405175 8:27316575-27316597 AGGGCTGGCAGCAGCATCTTCGG + Intronic
1039435438 8:37556521-37556543 AGGGCTGGCTGGAGCTGGTCAGG - Intergenic
1039897956 8:41729771-41729793 GGGGCTGGCAGGAGCCTGGCTGG - Intronic
1040572769 8:48624842-48624864 AGGGCTGAGGGGAGGATGCCCGG - Intergenic
1044719584 8:95133218-95133240 AGGGCTGGGTGGAGCACGTAGGG + Intergenic
1044963946 8:97557174-97557196 AGGGGTGGCTCGCGCATGTCCGG - Intergenic
1045650002 8:104332856-104332878 AGGCCTGGCGGGAGCGTGGCAGG + Intronic
1048684904 8:136893638-136893660 GAGGCTGGCGGGAACTTGTCTGG + Intergenic
1048927800 8:139286335-139286357 ATGGCTGGTGAGAGCATGGCCGG - Intergenic
1049867972 8:144950968-144950990 AGGGCTAGTGGGACCAGGTCTGG - Intergenic
1050248691 9:3720043-3720065 AGGGCTGATGGGAGCATGAGTGG - Intergenic
1050513263 9:6415935-6415957 AGGTCTGGCGTGAGGATTTCAGG - Intronic
1051748996 9:20322112-20322134 AGGGATGGCGGGGCCATGTGGGG + Intergenic
1056687602 9:88779285-88779307 AGGGCTGGAGGGAGCAAGCCTGG - Intergenic
1057236437 9:93365610-93365632 AGGCCTGCTGGGAGCATGCCTGG + Intergenic
1057718807 9:97516400-97516422 AGGGGTGCCGGGAGCCTGTGTGG + Intronic
1060526101 9:124322174-124322196 AGGGCTGGGGAGAGCATCTTGGG - Intronic
1060740130 9:126092405-126092427 GGGGGTGGAGGGAGCATGCCAGG + Intergenic
1060776710 9:126379952-126379974 AGGATGGGCGGGAGCTTGTCAGG + Intronic
1060919029 9:127407375-127407397 TGGGCTGGAGGGAGCATGACAGG - Exonic
1061189286 9:129072237-129072259 AGGGATGGCTGGATCCTGTCAGG - Intergenic
1061498615 9:130989915-130989937 AGGGCTGCCTGGAGGATGGCGGG + Intergenic
1062284650 9:135767676-135767698 AGGGTTGGCAGGAGCAGGCCCGG - Intronic
1062321037 9:135990717-135990739 AGGGCTGGGGAGGGCAGGTCGGG - Intergenic
1185932753 X:4221246-4221268 AGGGCTGGAGGGAGAGTGTATGG - Intergenic
1186062899 X:5730057-5730079 GGGGCAGGGAGGAGCATGTCTGG - Intergenic
1189908088 X:45782454-45782476 AGGCCTGGCTGGAGCATCTCTGG - Intergenic
1190727455 X:53198899-53198921 AGGGCAGGCAAGAGCATGTCTGG + Intronic
1192962518 X:76145378-76145400 AGGGCTGGCGGGGGGAGGGCCGG + Intergenic
1192963015 X:76149709-76149731 AGGGCTGGCGGGGGGAGGGCCGG - Intergenic
1195066708 X:101244023-101244045 AGGGGAGGCTGGAGCATGTAAGG + Intronic
1195343765 X:103928447-103928469 TGGGCTGCAGGGATCATGTCTGG + Intronic
1195363221 X:104104884-104104906 TGGGCTGCCGGGCTCATGTCTGG - Exonic
1196704653 X:118706583-118706605 GGGGCTGGCTGGACTATGTCTGG + Intergenic
1198312499 X:135435976-135435998 AGAGCTGGCAGGAGCAGGACCGG + Intergenic