ID: 1091406837

View in Genome Browser
Species Human (GRCh38)
Location 12:214433-214455
Sequence AAGGGCAAGGAGGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4467
Summary {0: 1, 1: 3, 2: 58, 3: 658, 4: 3747}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091406837_1091406860 28 Left 1091406837 12:214433-214455 CCCTCCTCCTCCTCCTTGCCCTT 0: 1
1: 3
2: 58
3: 658
4: 3747
Right 1091406860 12:214484-214506 TCCAGAACCATCTCCTTCCCAGG 0: 1
1: 0
2: 0
3: 36
4: 301
1091406837_1091406862 29 Left 1091406837 12:214433-214455 CCCTCCTCCTCCTCCTTGCCCTT 0: 1
1: 3
2: 58
3: 658
4: 3747
Right 1091406862 12:214485-214507 CCAGAACCATCTCCTTCCCAGGG 0: 1
1: 0
2: 3
3: 35
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091406837 Original CRISPR AAGGGCAAGGAGGAGGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr