ID: 1091407152

View in Genome Browser
Species Human (GRCh38)
Location 12:216192-216214
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 6, 1: 1, 2: 2, 3: 21, 4: 284}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091407152_1091407162 26 Left 1091407152 12:216192-216214 CCTTCCTCACTCAAGTTCTCCTA 0: 6
1: 1
2: 2
3: 21
4: 284
Right 1091407162 12:216241-216263 ACTGGTTAGTAAACTTCTGGAGG 0: 1
1: 1
2: 4
3: 21
4: 100
1091407152_1091407155 -4 Left 1091407152 12:216192-216214 CCTTCCTCACTCAAGTTCTCCTA 0: 6
1: 1
2: 2
3: 21
4: 284
Right 1091407155 12:216211-216233 CCTAGCCTCCAAGACCCACTTGG 0: 7
1: 0
2: 1
3: 11
4: 164
1091407152_1091407158 8 Left 1091407152 12:216192-216214 CCTTCCTCACTCAAGTTCTCCTA 0: 6
1: 1
2: 2
3: 21
4: 284
Right 1091407158 12:216223-216245 GACCCACTTGGTATTCAGACTGG 0: 2
1: 2
2: 0
3: 8
4: 61
1091407152_1091407161 23 Left 1091407152 12:216192-216214 CCTTCCTCACTCAAGTTCTCCTA 0: 6
1: 1
2: 2
3: 21
4: 284
Right 1091407161 12:216238-216260 CAGACTGGTTAGTAAACTTCTGG 0: 1
1: 1
2: 4
3: 10
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091407152 Original CRISPR TAGGAGAACTTGAGTGAGGA AGG (reversed) Intergenic
902185899 1:14725240-14725262 TAGATGAAGGTGAGTGAGGAGGG - Intronic
903895262 1:26598825-26598847 TAGGAGAAGTTGAGCTGGGAAGG + Intergenic
904008789 1:27378307-27378329 CAGGAGAGCCTGAGAGAGGAAGG + Intergenic
904686446 1:32264274-32264296 TAGGAGAATGTGAGGCAGGAAGG - Intronic
904885687 1:33736590-33736612 TAAGAGCACTTGATTCAGGAGGG + Intronic
905078441 1:35295399-35295421 TAGCTGAACATGAGTGAGCAAGG + Intronic
905264122 1:36739380-36739402 TGGGAGAACTTGAGGGAGGGAGG - Intergenic
905312643 1:37060824-37060846 TATGTGACCTTGGGTGAGGATGG - Intergenic
905560027 1:38919112-38919134 GAGGAGAAAATGAGAGAGGATGG - Exonic
906263813 1:44412980-44413002 TCTGAGGACTTGAGTGAAGAGGG + Intronic
907615338 1:55918727-55918749 TAAGAGTCCTTGAGTTAGGAAGG + Intergenic
911532818 1:99065826-99065848 AAGGTAAACTTGAGTCAGGAGGG + Intergenic
914764219 1:150623853-150623875 TAGGAGAAAGTTGGTGAGGAAGG - Intronic
915536096 1:156536475-156536497 TAGGAGAAGGGGAGAGAGGATGG + Intronic
915805340 1:158842979-158843001 TAGGAGAACAAGACTGAGAAAGG + Intronic
916556749 1:165900031-165900053 TAGGACAACATACGTGAGGAAGG - Intronic
917051276 1:170926789-170926811 TGGGAGAACTTGAGAGGAGAGGG + Intergenic
917139388 1:171819829-171819851 AAAGAGAAGTTGAGTGAGGGTGG + Intergenic
917608679 1:176663804-176663826 CAGGAGAACTTGAGAGAAAATGG - Intronic
918381288 1:183958202-183958224 TTGAAGAATTTGAGTGAGGTGGG - Intronic
919744513 1:201000185-201000207 TAGGAGAACGTGGGGGAGGGAGG + Intronic
922094576 1:222432073-222432095 GAGAAGAACTTGAGTAAGGAAGG - Intergenic
922375074 1:224955535-224955557 TGGCAGAATTTGAGTGAAGAAGG - Intronic
924931268 1:248734254-248734276 TCTGAGAACAAGAGTGAGGAGGG - Intronic
1062897144 10:1112380-1112402 TAGGAGAAGGTGAGAGACGAAGG - Intronic
1063921974 10:10942351-10942373 TATGAAAACTTGACTGTGGATGG + Intergenic
1064065840 10:12180861-12180883 TTGGTGAACTAGAGGGAGGAAGG - Intronic
1065905466 10:30247327-30247349 TAGGAGCAGTTGAAGGAGGAGGG - Intergenic
1066753411 10:38683854-38683876 TAGGTGAATTTGAGGGTGGAGGG + Intergenic
1067948263 10:50705340-50705362 AGGAAGAACTTGACTGAGGATGG - Intergenic
1069622536 10:69846680-69846702 TGGGAGCACTGGAGGGAGGAAGG - Intronic
1070883577 10:79870335-79870357 AGGAAGAACTTGACTGAGGATGG - Intergenic
1071650137 10:87386645-87386667 AGGAAGAACTTGACTGAGGATGG - Intergenic
1071994277 10:91131476-91131498 TAAGAGAACTTGAGTGTAGTTGG - Intergenic
1072276378 10:93827419-93827441 TAGGACAGCTTGAGTGAAGATGG - Intergenic
1072296441 10:94013299-94013321 TAGGAGGAGTGAAGTGAGGAGGG + Intronic
1072747091 10:97948366-97948388 GAGGAGAGCTAGACTGAGGAGGG + Intronic
1073029198 10:100511310-100511332 TAGGTGGAGTTAAGTGAGGAAGG + Intronic
1073866498 10:107810371-107810393 TAAGAGAAGATGAGAGAGGAAGG - Intergenic
1076672314 10:132130102-132130124 TAGGAGAGCTTGTATGATGAGGG - Intronic
1079526700 11:21398592-21398614 TCAGAGAGTTTGAGTGAGGAGGG + Intronic
1081012694 11:37835005-37835027 GAGGAGTGCTAGAGTGAGGAAGG - Intergenic
1081366256 11:42239014-42239036 AAGGTGAATTTGAGTGTGGAAGG + Intergenic
1081508208 11:43740202-43740224 TAGCATGAATTGAGTGAGGAGGG + Intronic
1081654624 11:44849289-44849311 AAGCAGGACCTGAGTGAGGATGG + Intronic
1081917187 11:46739935-46739957 TAGAAAATATTGAGTGAGGACGG + Intergenic
1084494326 11:69495318-69495340 TAGCAGGTCTTAAGTGAGGAGGG + Intergenic
1085173180 11:74465923-74465945 TAGGAGACCTGGAGTGGGAAAGG - Intronic
1085758183 11:79218846-79218868 GAGGGGAAATTGAGTTAGGAAGG + Intronic
1086048465 11:82560910-82560932 GAGGAGAACTTGAGGGAGTTAGG + Intergenic
1088264322 11:107975041-107975063 TAGGAGAACTTGAGCCTGGGAGG + Intergenic
1088345984 11:108825611-108825633 TAGGTGAACATGAATGAGAATGG - Intronic
1088783830 11:113162984-113163006 TAGGGGAATTTGAGTGTGAAGGG - Intronic
1088991836 11:114960712-114960734 CAGGAGAAATTGAGTGAGACTGG - Intergenic
1089636494 11:119817123-119817145 GATGAGAACTTGAGTCTGGAAGG + Intergenic
1090572384 11:128061453-128061475 CAGAAGAACTTGAATGAGGCTGG + Intergenic
1091216365 11:133904802-133904824 TTGGAGAACTGGAGGGTGGAGGG - Intergenic
1091240703 11:134050429-134050451 GAGGATCACTTGAGTGAGGGAGG + Intergenic
1091407126 12:216002-216024 TAGGAAAACTTGAGTGAGGAAGG - Intergenic
1091407139 12:216097-216119 TAGGAGAACTTGAGTGAGGAAGG - Intergenic
1091407152 12:216192-216214 TAGGAGAACTTGAGTGAGGAAGG - Intergenic
1091407165 12:216287-216309 TAGGAGAACTTGAGTGAGGAAGG - Intergenic
1091407182 12:216382-216404 TAGGAGAACTTGAGTGAGGAAGG - Intergenic
1091407195 12:216477-216499 TAGGAGAACTTGAGTGAGGAAGG - Intergenic
1091407211 12:216572-216594 TAGGAGAACTTGAGTGAGGAAGG - Intergenic
1091494872 12:963853-963875 CAGCAGAACTAGAGTGACGAGGG + Intronic
1091947023 12:4555738-4555760 TAGAAGGAGGTGAGTGAGGATGG - Intronic
1092739463 12:11614146-11614168 AAGGAGAAATTGAGGGTGGAAGG + Intergenic
1092803077 12:12190423-12190445 TATGAAAACTTCAGTGAGGTTGG - Intronic
1092906771 12:13107460-13107482 TATGAGAAGCTGAGGGAGGATGG + Intronic
1094696833 12:32827990-32828012 TAGGAGAAGTAGAGTGAGGAAGG + Intronic
1096529608 12:52234457-52234479 AAGGAGAACGTGAGGGAGGCGGG - Intronic
1097587912 12:61536949-61536971 TAGGAGAAGATGGGAGAGGACGG - Intergenic
1098579236 12:72079343-72079365 AAGTAGACCTTCAGTGAGGAGGG - Intronic
1099073935 12:78081771-78081793 AAGGGGCACTTGAGTGTGGAAGG - Intronic
1100162498 12:91876465-91876487 TAAGAGAAATAGAGAGAGGAAGG - Intergenic
1101502270 12:105315292-105315314 AAGTAGAACTTGTTTGAGGAAGG - Intronic
1103550573 12:121734194-121734216 TGGGAAAACTTGAGTGGCGAGGG + Intronic
1104235970 12:126936917-126936939 GAGGAGAGCTGGAGAGAGGATGG + Intergenic
1104999867 12:132683285-132683307 CAGGAGAGCTAGAGTCAGGAAGG + Intronic
1105073613 12:133254218-133254240 TATGAGAACTGGAGTGAGGACGG + Intergenic
1105612732 13:21983247-21983269 TAGCACAACTTGAGTGAGCGAGG + Intergenic
1106466107 13:30015940-30015962 TAGGAGCACTAGAGTGTGGGTGG - Intergenic
1106820105 13:33455318-33455340 TAAGAGAATTTGAGAGAGGCAGG + Intergenic
1107056884 13:36115418-36115440 TAGGTGAACTTGAACAAGGATGG + Intronic
1107559104 13:41544579-41544601 AAGCAAAACTTGAGTGAGGATGG + Intergenic
1108116590 13:47135605-47135627 TAGGAGAACAAGAGTGAAGGTGG - Intergenic
1108195796 13:47993623-47993645 CAGGAGAAGTTGAGTTAGCATGG - Intronic
1108293909 13:48992586-48992608 TAGGAAAATTTGAGAGATGACGG + Intronic
1108493093 13:51000500-51000522 CTGGAGAACTTGAGTGGTGAGGG - Intergenic
1108584899 13:51862706-51862728 TAGGTGAACTGAAGTGAGGTTGG + Intronic
1109140678 13:58711315-58711337 CAGGAGAATTTTACTGAGGAGGG + Intergenic
1109693863 13:65928104-65928126 GAAGAGAAGTTGAATGAGGAGGG + Intergenic
1113991517 14:16030841-16030863 TGGGTGAACTCGATTGAGGAGGG + Intergenic
1114373152 14:22112392-22112414 TAGGAGAAGTTGGATGAAGAGGG + Intergenic
1114634472 14:24179571-24179593 TAGGAGGACATGAGAGAGTAGGG - Intronic
1115762111 14:36584920-36584942 TTCGAGAACCTGAGGGAGGAGGG - Intergenic
1116019862 14:39447262-39447284 TTGAAGGAATTGAGTGAGGAAGG + Intergenic
1117282450 14:54254176-54254198 TCAGGGAGCTTGAGTGAGGAGGG - Intergenic
1117581693 14:57157807-57157829 TAGGAGCTCTGGAGTGAAGATGG - Intergenic
1117975015 14:61288624-61288646 TAGGAAAAGTTCTGTGAGGATGG + Intronic
1118249805 14:64148537-64148559 GAGGAGAACCTGTGTGTGGATGG - Intronic
1118818050 14:69326557-69326579 GAGGAGAGCTGGAGTGAGCAGGG + Intronic
1118896377 14:69949205-69949227 TGGGAGAACATGGCTGAGGACGG + Intronic
1120743989 14:88137472-88137494 TTGGAGAGCCTGAGTGTGGAAGG - Intergenic
1121532628 14:94668019-94668041 TAGCAGAACTTGAGATAGGGAGG - Intergenic
1122622450 14:103067506-103067528 GAGGATCACTTGAGTGCGGAAGG - Intergenic
1123408457 15:20038932-20038954 TTGGAGAACTTGAAAGAAGAGGG + Intergenic
1123517781 15:21045573-21045595 TTGGAGAACTTGAAAGAAGAGGG + Intergenic
1125023204 15:35005289-35005311 TTGGAGAACTTGTGTGAGAATGG - Intergenic
1125492104 15:40155898-40155920 TAGGGGAACTTGAAAGAGGATGG - Intergenic
1126685115 15:51241608-51241630 GAGGAGAAATCCAGTGAGGAAGG + Intronic
1126870384 15:52980916-52980938 TTTGAGAACATGAGTGTGGAGGG - Intergenic
1128565097 15:68695879-68695901 TAGGAGAAATAGAGATAGGAGGG + Intronic
1130512090 15:84598379-84598401 TGGGAGAATTTGTGTGAGAAAGG + Intergenic
1130821032 15:87495950-87495972 TAGGAGAGCTTGATTTTGGAGGG - Intergenic
1133399753 16:5476865-5476887 TGGGAGAACTAGATTGAGAAAGG - Intergenic
1133920618 16:10149740-10149762 TAGGAGTTCTGGAGTGAGGAGGG - Intronic
1134153870 16:11826707-11826729 GAGGATCACTTGAGTGTGGAAGG - Intergenic
1134596477 16:15500014-15500036 TAGTGGAAATTGAGTGAGGGGGG + Intronic
1136729297 16:32393137-32393159 TAGGTGAATTTGAGGGTGGAGGG - Intergenic
1136910703 16:34141965-34141987 TGGGTGAACTCGATTGAGGAGGG + Intergenic
1136982962 16:35074900-35074922 TAAGAGTACTTGGGTGAAGATGG + Intergenic
1138026481 16:53526125-53526147 GCGGGGAACTCGAGTGAGGAGGG + Intergenic
1138255657 16:55556847-55556869 TAGGAGGATTTGAGTGGGGAAGG + Intronic
1138509003 16:57497194-57497216 TAGGAGAGGTTAAATGAGGATGG + Intergenic
1202997099 16_KI270728v1_random:124384-124406 TAGGTGAATTTGAGGGTGGAGGG + Intergenic
1203023786 16_KI270728v1_random:436726-436748 TAGGTGAATTTGAGGGTGGAGGG + Intergenic
1143813880 17:9495316-9495338 TAGGAGCACTTGGTTGAGGATGG - Intronic
1145221930 17:21096604-21096626 TAGGATAAGTTGGGTGGGGAAGG + Intergenic
1147151004 17:38513772-38513794 TAGTAGACTTTGAGTGAGAATGG + Intergenic
1147844713 17:43396900-43396922 TATCAGCACTTGATTGAGGAGGG + Intergenic
1150872007 17:68922706-68922728 TGGGAGACCTTGAATCAGGATGG - Intronic
1150901025 17:69277078-69277100 TAGGAGAACCTAACTGAGAAGGG + Intronic
1151649259 17:75456248-75456270 TAGAAGAACTTAAGAGAGGCGGG + Intronic
1151917744 17:77131001-77131023 TAGGAGAAAATTAGTGACGATGG + Intronic
1153106704 18:1536423-1536445 TAGGAGAAAGAAAGTGAGGAAGG - Intergenic
1153775210 18:8447163-8447185 TAGGTAAACTTGAGTCATGAGGG - Intergenic
1154022143 18:10673502-10673524 TAGGTGAAGGTGGGTGAGGAGGG + Intronic
1156120526 18:33837167-33837189 TTGGAGATATTGAGTGGGGATGG - Intergenic
1159551189 18:69897094-69897116 TGAGAGAACTGGAGTGAAGAGGG - Intronic
1160272101 18:77396549-77396571 TAGGAGAGATTGTGGGAGGAAGG - Intergenic
1161201352 19:3016697-3016719 TAGGCGAACGGAAGTGAGGATGG + Intronic
1161788097 19:6340714-6340736 CCGGAGAACTTGAGTGATCATGG + Intergenic
1162319220 19:9960883-9960905 TAGGAGAACTGGTGAGAGGAGGG + Exonic
1163202465 19:15778665-15778687 GGGGAGTACGTGAGTGAGGAGGG + Intergenic
1163202498 19:15778925-15778947 GAGGAGTGCGTGAGTGAGGAGGG + Intergenic
1165328739 19:35129191-35129213 TTGGATAACTTGAATGAAGAGGG + Intronic
1166212918 19:41318766-41318788 GAGGAGCACTCGAGAGAGGATGG + Intronic
925178597 2:1801980-1802002 TAGGGGAACTTAGGTGGGGAAGG - Intronic
925375545 2:3381771-3381793 CAGGAGAGCTTGACTGGGGAGGG - Intronic
925879428 2:8339835-8339857 CAGGAGAACTTCAGTGGGGGTGG + Intergenic
926198118 2:10775734-10775756 CAGGAGAACCTGAGTATGGAAGG - Intronic
926327882 2:11800672-11800694 TAGGAGATCTTAAGGGAGGCAGG + Intronic
926653782 2:15376056-15376078 TAGGGGAACTAGAATGAGGAGGG + Intronic
930425605 2:51208694-51208716 AATGATAACTTGTGTGAGGAAGG - Intergenic
931996928 2:67847708-67847730 TAGGTGAAGTTGTGAGAGGAGGG - Intergenic
933299231 2:80523891-80523913 TAGGGGAAATTGGTTGAGGAAGG + Intronic
934185597 2:89671048-89671070 TAGGTGAATTTGAGGGTGGAGGG - Intergenic
934476492 2:94597027-94597049 CAGGAGGACTTGTGTGAAGAAGG + Intronic
937924222 2:127155155-127155177 TAAAAGAACTGGAGTGAGGCTGG - Intergenic
937981348 2:127617881-127617903 TATAAGGACTTGAGCGAGGAAGG - Intronic
939521090 2:143231637-143231659 TGGAAGAACTTCAGTGAGAAAGG - Intronic
942539496 2:177001062-177001084 GAGGAGAAAATGAATGAGGACGG - Intergenic
946172998 2:217906321-217906343 GAGGACAACGTGAGTGTGGATGG - Exonic
946484080 2:220084344-220084366 TACGAAACCTTCAGTGAGGAAGG - Intergenic
946705464 2:222454415-222454437 TAGGAGAGCTTGGATGAGGAAGG + Intronic
946811539 2:223530776-223530798 GAGGAGAGCTGGAGAGAGGATGG - Intergenic
948602548 2:239115649-239115671 GAGGAGAGCTTGAGTGTGAAGGG + Intronic
1169302707 20:4458120-4458142 TAGGAGCATTTGCTTGAGGAGGG + Intergenic
1169634770 20:7676969-7676991 AAAGGGAACATGAGTGAGGAGGG + Intergenic
1170352232 20:15454349-15454371 TAGGGGAACATGAGAGGGGAAGG - Intronic
1170413856 20:16119730-16119752 TAGGTAAACTTGTGTAAGGAGGG - Intergenic
1170465164 20:16616143-16616165 TAAGAGAAAGTGAGTGATGAGGG - Intergenic
1171136247 20:22697065-22697087 TTAGAGAACATGAGAGAGGAGGG - Intergenic
1171770360 20:29318845-29318867 TGGGTGAACTCGATTGAGGAGGG - Intergenic
1171813070 20:29761643-29761665 TGGGTGAACTCGATTGAGGAGGG - Intergenic
1171906162 20:30900673-30900695 TGGGTGAACTCGATTGAGGAGGG + Intergenic
1172343845 20:34181169-34181191 TGAGAGAGCTTTAGTGAGGAGGG - Intergenic
1174716812 20:52767584-52767606 AAGGAGAACTAAAGTGAGGATGG - Intergenic
1175211084 20:57355771-57355793 TAGGAGAACAGGAGGGAGGATGG + Intronic
1179068741 21:38052233-38052255 TAGGAGGAATTGGGTGAGGTGGG + Intronic
1179197788 21:39182472-39182494 TAGGTAAACGTGAGTGAGCATGG + Intronic
1180315753 22:11276683-11276705 TGGGTGAACTCGATTGAGGAGGG - Intergenic
1180339585 22:11606791-11606813 TGGGTGAACTCGATTGAGGAGGG + Intergenic
1182277824 22:29201578-29201600 TAGGAGAAATTGCCAGAGGAGGG + Intergenic
1182384983 22:29930600-29930622 GAGGATAACTTGAGCCAGGAAGG + Intronic
949964182 3:9341339-9341361 AAGGAGCACTTGAGTGTGGAGGG - Intronic
950600737 3:14033178-14033200 CAGGACAACTTGAGGCAGGAAGG + Intronic
952041392 3:29266210-29266232 TAGGAGAGAGTGAGTGGGGATGG + Intergenic
953444418 3:42950560-42950582 TAGGGGTACCTGAGTGAGAAAGG - Intronic
955249954 3:57270863-57270885 TAGGAGAAGTTGACCAAGGAAGG + Exonic
957989893 3:87614496-87614518 GAGGAGGAATTGAGTGAGGAGGG + Intergenic
958658176 3:97030526-97030548 TAGGAGAACTTTAGTGGCTAAGG - Intronic
958942002 3:100327078-100327100 TTGGAGAAATTGATTAAGGAAGG + Intergenic
961542488 3:127609386-127609408 TAGGATAACTTGTGTCATGAGGG + Intronic
964027599 3:152096629-152096651 TGGGAGCTCTTGGGTGAGGATGG - Intergenic
965264904 3:166531061-166531083 AAGGAGAATTAGAGTGAAGAGGG + Intergenic
966658223 3:182383758-182383780 TAGGCGATCTTGAGTGGGAAGGG - Intergenic
969159738 4:5246557-5246579 TATGACAAGTTGAGAGAGGAAGG - Intronic
969305958 4:6326454-6326476 AAGGAGAACTTCATGGAGGAGGG + Intronic
969501802 4:7558050-7558072 GAGGAGGTGTTGAGTGAGGAGGG + Intronic
969512941 4:7629987-7630009 TAGGAGAACTGGAGGGGAGAGGG - Intronic
971839521 4:31833470-31833492 TAGGTGAAATAGTGTGAGGATGG + Intergenic
972025306 4:34368929-34368951 TAAGAGAACTTGAGTTTGAAGGG - Intergenic
973259374 4:48146018-48146040 TACAAGAACGTGAGTAAGGATGG - Intronic
974235959 4:59181078-59181100 TAGTGGAGCTTGAGTCAGGAAGG + Intergenic
977271101 4:94917970-94917992 CAGGAGAAAGAGAGTGAGGAGGG - Intronic
977948696 4:102944216-102944238 TAGGTGAATTTGAGGGTGGAGGG + Intronic
978770919 4:112455905-112455927 TAGGAGCAGTTGTGTGAAGATGG + Intergenic
979827097 4:125251407-125251429 TAGGAGAACTGGTGTGAGCCAGG + Intergenic
980105542 4:128584848-128584870 TTGGAGAATTAGACTGAGGATGG + Intergenic
985286534 4:188341835-188341857 TAGGAGAAACTGAGTTAGGACGG - Intergenic
986181041 5:5393186-5393208 TGGGAGAAATGGAGTGAGGCTGG - Intergenic
986351314 5:6882354-6882376 TTGGAGAACGTGAGTAAGAAGGG - Intergenic
987025910 5:13926188-13926210 AAGGAGCACCTGAGGGAGGATGG + Intronic
987178001 5:15336462-15336484 CAGGAGAATTTGAGTGAGAGTGG + Intergenic
987812349 5:22853861-22853883 TAGGAGAAATTGCTTGAGCATGG - Intergenic
987875648 5:23677167-23677189 GAGGAGTACTAGAGTGGGGAAGG + Intergenic
988933376 5:36059143-36059165 TACAGGGACTTGAGTGAGGAAGG + Intronic
988974501 5:36501618-36501640 TAGGTGAACTTGTGTCATGAGGG - Intergenic
989524692 5:42440289-42440311 TATGAGAACTTGACTCAGGTTGG + Intronic
991234207 5:64375466-64375488 TAAGACAAGTTGACTGAGGAAGG + Intergenic
991570327 5:68046973-68046995 TAGGTAAACTTGTGTTAGGAGGG - Intergenic
992255268 5:74914779-74914801 TAGGGGAAATTCTGTGAGGAGGG + Intergenic
992838737 5:80667027-80667049 TAGGAAAACTTGTGTCATGAGGG - Intronic
993417259 5:87650428-87650450 TAGGAAGACTTGATTGAGGCTGG - Intergenic
993453642 5:88102195-88102217 TAGGTGAACTTGTGTCATGAGGG + Intergenic
995548772 5:113258687-113258709 TAGGAGAACTGAGGTGAGGGTGG + Intronic
996148685 5:120008306-120008328 TAGGAGAACCTCAGTGGGGATGG + Intergenic
999377785 5:151098825-151098847 TTGGAGTTCTTGAGTGGGGAAGG - Intergenic
1003265035 6:4558195-4558217 TAGGAGAACCAGAGATAGGATGG + Intergenic
1003375509 6:5573276-5573298 TGAGAGAAATGGAGTGAGGAGGG - Intronic
1003555714 6:7137968-7137990 TAGGCGTAAGTGAGTGAGGAGGG - Intronic
1004005296 6:11632531-11632553 GGGGAGAACATGAATGAGGATGG - Intergenic
1004243851 6:13953441-13953463 TAGGAGAGACTGGGTGAGGATGG + Intronic
1004685970 6:17944276-17944298 TATAAGAACTTGAGTGTGTATGG - Intronic
1005197999 6:23311158-23311180 TAGGTGAACTTCAGTGAGACAGG - Intergenic
1005419127 6:25630996-25631018 TGGGAGAGGTGGAGTGAGGAAGG + Intergenic
1006049609 6:31331549-31331571 TAGGAGACCTTGAGTCCTGAGGG + Intronic
1007738046 6:43994164-43994186 TAGGATCCCTTGAGGGAGGAGGG + Intergenic
1007813613 6:44504124-44504146 TGGGGGAGCTTGAGTGGGGAGGG + Intergenic
1008287326 6:49669968-49669990 TTAGAGAACTAGAGGGAGGAAGG - Intergenic
1010911786 6:81567375-81567397 GAGGATCACTTGAGTCAGGAAGG - Intronic
1011108807 6:83813579-83813601 TAGGAGAACCTGAGTCTGGGAGG + Intergenic
1012299938 6:97573733-97573755 TAGGTAAACTTGTGTGATGAGGG - Intergenic
1012462697 6:99481655-99481677 TGGGAGAGATTGAGGGAGGAAGG - Intronic
1015410130 6:132884977-132884999 GAGGATCACTTGAGTGTGGAGGG + Intergenic
1015522755 6:134147795-134147817 TTGGAGGACTGGAGTAAGGAAGG + Intergenic
1016554345 6:145318774-145318796 AAGGAGAAACTGAGTAAGGAAGG + Intergenic
1017053377 6:150415190-150415212 TATGAGAACTTGAAAGATGAAGG + Intergenic
1017056516 6:150441492-150441514 TAGGAGAAGGTGGATGAGGAGGG - Intergenic
1018047452 6:159978294-159978316 TGGGGGAATCTGAGTGAGGAAGG - Intronic
1018845881 6:167555108-167555130 TAGGAGCACTTGACTGATAAGGG - Intergenic
1021414890 7:20372376-20372398 TAGGTAAACTTGAGAGAGAATGG + Intronic
1022835538 7:34110298-34110320 TGGGAGAAGCTGAGTGGGGAAGG - Intronic
1025091832 7:56070538-56070560 GAGGATCACTTGAGTGTGGAAGG + Intronic
1027513288 7:79110098-79110120 TAGGAGAGCAAGAGTGAAGAAGG + Intronic
1027536869 7:79414296-79414318 AAGGACAACTTGAGAGAGGAAGG - Intronic
1030021203 7:105276952-105276974 CAGGAGAAGTAGAGTTAGGATGG - Intronic
1030184380 7:106746378-106746400 TAGGAGAAGTTCAGTAAGAAAGG - Intergenic
1030224396 7:107132699-107132721 TGGGAAAACTTGAAGGAGGAAGG + Intronic
1033798404 7:144874098-144874120 TATGAGAACAGGAGAGAGGAAGG - Intergenic
1034193589 7:149229144-149229166 TAGGAGAATGAGATTGAGGATGG + Intergenic
1034210919 7:149361781-149361803 CAGGAGAACTAGAATTAGGAGGG + Intergenic
1035494183 7:159307644-159307666 TATGAGAATTGGAGTGAGGACGG + Intergenic
1035622364 8:1043601-1043623 TAGGAGGACTGCAGTGGGGAAGG + Intergenic
1035944959 8:3952240-3952262 CAGGAGAATAAGAGTGAGGAAGG - Intronic
1036221646 8:6926000-6926022 GAGGAGAACAGCAGTGAGGATGG + Exonic
1039080767 8:33732087-33732109 AAGTAGAAATTGACTGAGGAAGG + Intergenic
1040361990 8:46674360-46674382 TGAGAGAACTAGAGGGAGGAAGG + Intergenic
1043602153 8:81953569-81953591 GAAGAGAACATGAGAGAGGAAGG - Intergenic
1043730756 8:83677195-83677217 TAGGAAAACTTGTGTCATGAGGG - Intergenic
1044734564 8:95266941-95266963 TAGGAGAACTAGCATGCGGAGGG - Intronic
1047676823 8:127211844-127211866 TTGGGGGAGTTGAGTGAGGAGGG - Intergenic
1047836937 8:128704162-128704184 AAGGAAAATTTGGGTGAGGAAGG - Intergenic
1048111782 8:131475196-131475218 TATGAGAGCTTGAGAGTGGAAGG - Intergenic
1048798332 8:138172308-138172330 TAGGAGAACGTCAGTGGGGCTGG - Intronic
1049261182 8:141640128-141640150 ATGGAGAACTTGAGAGAGGCTGG + Intergenic
1049643318 8:143725181-143725203 GAGGAGACCTTGAGAGAGGGAGG + Exonic
1049755846 8:144311018-144311040 GATGAGAACTTGTGTGTGGAGGG - Intronic
1051053410 9:12956203-12956225 TAGGGGTCCTTGAGTGGGGATGG - Intergenic
1051638223 9:19200767-19200789 AAGGAGAACTGGAGAAAGGAAGG - Intergenic
1052346158 9:27411908-27411930 TAGGGGAAATTGTGGGAGGAAGG + Intronic
1053102257 9:35380888-35380910 TAGGAGAACAGGAGTGTGGAGGG - Intronic
1053289155 9:36868626-36868648 TAAAAGAACTCGAGTTAGGAAGG + Intronic
1053365797 9:37521673-37521695 CAAGAGAACTTCAGCGAGGATGG - Exonic
1053681568 9:40489051-40489073 CAGGAGGACTTGTGTGAAGAAGG - Intergenic
1053748971 9:41234899-41234921 TAGGTGAACTCGATAGAGGAGGG - Intergenic
1053931562 9:43117381-43117403 CAGGAGGACTTGTGTGAAGAAGG - Intergenic
1054282145 9:63135883-63135905 CAGGAGGACTTGTGTGAAGAAGG + Intergenic
1054294659 9:63324568-63324590 CAGGAGGACTTGTGTGAAGAAGG - Intergenic
1054392679 9:64629055-64629077 CAGGAGGACTTGTGTGAAGAAGG - Intergenic
1054427329 9:65134264-65134286 CAGGAGGACTTGTGTGAAGAAGG - Intergenic
1054503047 9:65887276-65887298 CAGGAGGACTTGTGTGAAGAAGG + Intronic
1056061867 9:82891587-82891609 TAGGAGTCCTTGAGTGCTGAAGG - Intergenic
1056519766 9:87389438-87389460 TAGGGAAAGCTGAGTGAGGAAGG - Intergenic
1056985093 9:91356177-91356199 TACAAGCACTTGAGTGAGCAAGG + Intronic
1057381903 9:94576239-94576261 GAGGAAAACTTGATTAAGGAGGG - Intronic
1059037192 9:110767303-110767325 TGGGAGAATCTGAGTGTGGAAGG + Intronic
1059772610 9:117441940-117441962 TAGGAAAAGGTGGGTGAGGATGG + Intergenic
1060825555 9:126685710-126685732 TAGGAGATCTTGACTCAGCAAGG + Intronic
1061304858 9:129726325-129726347 TAAAAGAACTTGAGAGAGAAAGG + Intergenic
1061728128 9:132592492-132592514 GAGGAGAACTTTAGGGAAGAGGG - Intergenic
1203364043 Un_KI270442v1:242638-242660 TGGGTGAACTCGATTGAGGAGGG - Intergenic
1190497993 X:51045517-51045539 TTGGAAGCCTTGAGTGAGGAAGG + Intergenic
1190767158 X:53484868-53484890 TATGACCACTTGACTGAGGAAGG - Intergenic
1193738830 X:85193568-85193590 TAGGTGAACTTGTGTCATGATGG + Intergenic
1194350761 X:92823144-92823166 CAGGAGAACTTGAGGCAGGTTGG + Intergenic
1196274565 X:113751923-113751945 TTAGAGAACTGGAGGGAGGAAGG - Intergenic
1196348549 X:114698307-114698329 TAAGAGAACTTGGGTTAGCATGG + Intronic
1199394492 X:147318818-147318840 TAGGAGAATGGGATTGAGGAAGG - Intergenic
1200659088 Y:5939824-5939846 CAGGAGAACTTGAGGCAGGTTGG + Intergenic
1201184049 Y:11380653-11380675 TAGGTGAATTTGAGGGTGGAGGG + Intergenic