ID: 1091407158

View in Genome Browser
Species Human (GRCh38)
Location 12:216223-216245
Sequence GACCCACTTGGTATTCAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 2, 1: 2, 2: 0, 3: 8, 4: 61}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091407153_1091407158 4 Left 1091407153 12:216196-216218 CCTCACTCAAGTTCTCCTAGCCT 0: 6
1: 1
2: 1
3: 15
4: 169
Right 1091407158 12:216223-216245 GACCCACTTGGTATTCAGACTGG 0: 2
1: 2
2: 0
3: 8
4: 61
1091407151_1091407158 9 Left 1091407151 12:216191-216213 CCCTTCCTCACTCAAGTTCTCCT 0: 6
1: 1
2: 1
3: 33
4: 398
Right 1091407158 12:216223-216245 GACCCACTTGGTATTCAGACTGG 0: 2
1: 2
2: 0
3: 8
4: 61
1091407152_1091407158 8 Left 1091407152 12:216192-216214 CCTTCCTCACTCAAGTTCTCCTA 0: 6
1: 1
2: 2
3: 21
4: 284
Right 1091407158 12:216223-216245 GACCCACTTGGTATTCAGACTGG 0: 2
1: 2
2: 0
3: 8
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091407158 Original CRISPR GACCCACTTGGTATTCAGAC TGG Intergenic