ID: 1091407165

View in Genome Browser
Species Human (GRCh38)
Location 12:216287-216309
Sequence TAGGAGAACTTGAGTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 6, 1: 1, 2: 2, 3: 21, 4: 284}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091407165_1091407171 8 Left 1091407165 12:216287-216309 CCTTCCTCACTCAAGTTCTCCTA 0: 6
1: 1
2: 2
3: 21
4: 284
Right 1091407171 12:216318-216340 GACCCACTTGGTGTTCAGACCGG 0: 2
1: 2
2: 1
3: 5
4: 56
1091407165_1091407174 23 Left 1091407165 12:216287-216309 CCTTCCTCACTCAAGTTCTCCTA 0: 6
1: 1
2: 2
3: 21
4: 284
Right 1091407174 12:216333-216355 CAGACCGGTTAGTAAACCCCTGG 0: 1
1: 1
2: 2
3: 6
4: 31
1091407165_1091407168 -4 Left 1091407165 12:216287-216309 CCTTCCTCACTCAAGTTCTCCTA 0: 6
1: 1
2: 2
3: 21
4: 284
Right 1091407168 12:216306-216328 CCTAGCCTCCAAGACCCACTTGG 0: 7
1: 0
2: 1
3: 11
4: 164
1091407165_1091407175 26 Left 1091407165 12:216287-216309 CCTTCCTCACTCAAGTTCTCCTA 0: 6
1: 1
2: 2
3: 21
4: 284
Right 1091407175 12:216336-216358 ACCGGTTAGTAAACCCCTGGAGG 0: 1
1: 1
2: 1
3: 6
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091407165 Original CRISPR TAGGAGAACTTGAGTGAGGA AGG (reversed) Intergenic