ID: 1091407166

View in Genome Browser
Species Human (GRCh38)
Location 12:216291-216313
Sequence AGGCTAGGAGAACTTGAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 6, 1: 1, 2: 1, 3: 15, 4: 169}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091407166_1091407175 22 Left 1091407166 12:216291-216313 CCTCACTCAAGTTCTCCTAGCCT 0: 6
1: 1
2: 1
3: 15
4: 169
Right 1091407175 12:216336-216358 ACCGGTTAGTAAACCCCTGGAGG 0: 1
1: 1
2: 1
3: 6
4: 20
1091407166_1091407174 19 Left 1091407166 12:216291-216313 CCTCACTCAAGTTCTCCTAGCCT 0: 6
1: 1
2: 1
3: 15
4: 169
Right 1091407174 12:216333-216355 CAGACCGGTTAGTAAACCCCTGG 0: 1
1: 1
2: 2
3: 6
4: 31
1091407166_1091407171 4 Left 1091407166 12:216291-216313 CCTCACTCAAGTTCTCCTAGCCT 0: 6
1: 1
2: 1
3: 15
4: 169
Right 1091407171 12:216318-216340 GACCCACTTGGTGTTCAGACCGG 0: 2
1: 2
2: 1
3: 5
4: 56
1091407166_1091407168 -8 Left 1091407166 12:216291-216313 CCTCACTCAAGTTCTCCTAGCCT 0: 6
1: 1
2: 1
3: 15
4: 169
Right 1091407168 12:216306-216328 CCTAGCCTCCAAGACCCACTTGG 0: 7
1: 0
2: 1
3: 11
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091407166 Original CRISPR AGGCTAGGAGAACTTGAGTG AGG (reversed) Intergenic