ID: 1091407171

View in Genome Browser
Species Human (GRCh38)
Location 12:216318-216340
Sequence GACCCACTTGGTGTTCAGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 2, 1: 2, 2: 1, 3: 5, 4: 56}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091407165_1091407171 8 Left 1091407165 12:216287-216309 CCTTCCTCACTCAAGTTCTCCTA 0: 6
1: 1
2: 2
3: 21
4: 284
Right 1091407171 12:216318-216340 GACCCACTTGGTGTTCAGACCGG 0: 2
1: 2
2: 1
3: 5
4: 56
1091407166_1091407171 4 Left 1091407166 12:216291-216313 CCTCACTCAAGTTCTCCTAGCCT 0: 6
1: 1
2: 1
3: 15
4: 169
Right 1091407171 12:216318-216340 GACCCACTTGGTGTTCAGACCGG 0: 2
1: 2
2: 1
3: 5
4: 56
1091407164_1091407171 9 Left 1091407164 12:216286-216308 CCCTTCCTCACTCAAGTTCTCCT 0: 6
1: 1
2: 1
3: 33
4: 398
Right 1091407171 12:216318-216340 GACCCACTTGGTGTTCAGACCGG 0: 2
1: 2
2: 1
3: 5
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091407171 Original CRISPR GACCCACTTGGTGTTCAGAC CGG Intergenic