ID: 1091407193 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:216454-216476 |
| Sequence | GCTCAACATTAGAGAGTCTC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 91 | |||
| Summary | {0: 6, 1: 0, 2: 0, 3: 3, 4: 82} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1091407193_1091407198 | 19 | Left | 1091407193 | 12:216454-216476 | CCAGAGACTCTCTAATGTTGAGC | 0: 6 1: 0 2: 0 3: 3 4: 82 |
||
| Right | 1091407198 | 12:216496-216518 | CCTAGCCTCCAAGACCCACTTGG | 0: 7 1: 0 2: 1 3: 11 4: 164 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1091407193 | Original CRISPR | GCTCAACATTAGAGAGTCTC TGG (reversed) | Intergenic | ||