ID: 1091407194

View in Genome Browser
Species Human (GRCh38)
Location 12:216476-216498
Sequence AGGAGAACTTGAGTGAGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 6, 1: 1, 2: 1, 3: 33, 4: 398}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091407194_1091407205 27 Left 1091407194 12:216476-216498 CCCTTCCTCACTCAAGTTCTCCT 0: 6
1: 1
2: 1
3: 33
4: 398
Right 1091407205 12:216526-216548 ACTGGTTAGTAAACCCCTGGAGG 0: 1
1: 2
2: 1
3: 5
4: 73
1091407194_1091407198 -3 Left 1091407194 12:216476-216498 CCCTTCCTCACTCAAGTTCTCCT 0: 6
1: 1
2: 1
3: 33
4: 398
Right 1091407198 12:216496-216518 CCTAGCCTCCAAGACCCACTTGG 0: 7
1: 0
2: 1
3: 11
4: 164
1091407194_1091407201 9 Left 1091407194 12:216476-216498 CCCTTCCTCACTCAAGTTCTCCT 0: 6
1: 1
2: 1
3: 33
4: 398
Right 1091407201 12:216508-216530 GACCCACTTGGTGTTCAGACTGG 0: 2
1: 2
2: 1
3: 5
4: 56
1091407194_1091407204 24 Left 1091407194 12:216476-216498 CCCTTCCTCACTCAAGTTCTCCT 0: 6
1: 1
2: 1
3: 33
4: 398
Right 1091407204 12:216523-216545 CAGACTGGTTAGTAAACCCCTGG 0: 1
1: 3
2: 2
3: 6
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091407194 Original CRISPR AGGAGAACTTGAGTGAGGAA GGG (reversed) Intergenic
900772943 1:4560390-4560412 AGAAGAGTTTGAGTGAGGCAAGG + Intergenic
903640685 1:24857838-24857860 TTGAGTACTTGAGTGAGGCAAGG + Intergenic
903895263 1:26598826-26598848 AGGAGAAGTTGAGCTGGGAAGGG + Intergenic
904046839 1:27614331-27614353 GGGCGACCTGGAGTGAGGAAGGG + Intronic
904085089 1:27900585-27900607 AGGAGAACTGGAATTAGAAATGG + Intronic
905275484 1:36815243-36815265 AAGAGACAGTGAGTGAGGAAAGG - Intronic
905560026 1:38919111-38919133 AGGAGAAAATGAGAGAGGATGGG - Exonic
907550471 1:55300716-55300738 AGGAGAACCTGTGTCAGGACTGG + Intergenic
907615339 1:55918728-55918750 AAGAGTCCTTGAGTTAGGAAGGG + Intergenic
907847201 1:58219615-58219637 AGTAGAAATTGACTAAGGAAGGG - Intronic
908223717 1:62035064-62035086 GGGAGAAATTGAGTGGGAAAAGG + Intronic
908828563 1:68156967-68156989 TTGAGAACTTGAGGGCGGAAGGG + Intronic
908850336 1:68369468-68369490 AGCAGAACTGGGGTGGGGAATGG - Intergenic
909338861 1:74509225-74509247 ATGGCAACTTGACTGAGGAATGG - Intronic
909617868 1:77632797-77632819 AGGTGAATGTCAGTGAGGAAGGG - Exonic
910519735 1:88106153-88106175 AAGAGAACTTGTGTGAGGAGTGG - Intergenic
910523109 1:88146031-88146053 AGTAGAGCTTGAGCGAGGCAGGG - Intergenic
910532218 1:88250470-88250492 AGGAGAAAGGGAGGGAGGAAGGG + Intergenic
910987135 1:93016393-93016415 AGAGGAGCTGGAGTGAGGAACGG + Intergenic
911532819 1:99065827-99065849 AGGTAAACTTGAGTCAGGAGGGG + Intergenic
913178808 1:116299399-116299421 AGGAGGAGTTGAGTAAGGTAAGG - Intergenic
913459430 1:119068500-119068522 AGGAAAAGTTGAGGGAGGAAAGG - Intronic
913690936 1:121279230-121279252 AGGAGAAAATGGGGGAGGAAGGG - Intronic
914146604 1:145000733-145000755 AGGAGAAAATGGGGGAGGAAGGG + Intronic
914898357 1:151697028-151697050 TGGAGAAGGTGAGGGAGGAAAGG - Exonic
914908636 1:151767202-151767224 AGGAGCACTGGAGGCAGGAACGG - Exonic
915708955 1:157875030-157875052 AGGAGGTCTAGAGTGAGAAAAGG - Intronic
915805341 1:158842980-158843002 AGGAGAACAAGACTGAGAAAGGG + Intronic
915971052 1:160355581-160355603 AGGAGCATTTGAGGGAGGAAAGG + Intronic
916459749 1:165011201-165011223 AGGGGAAAATGAGTTAGGAATGG + Intergenic
916599914 1:166282874-166282896 GTGAGAACTTGCTTGAGGAAAGG + Intergenic
916679439 1:167090535-167090557 AGGGGAACTTGAGGGAAGTAGGG - Exonic
918095823 1:181333265-181333287 AGGAGAAATAAAGTGAGTAAAGG - Intergenic
918223325 1:182455952-182455974 AGGAGACCTTAATGGAGGAAGGG + Intronic
918469967 1:184861727-184861749 AGGAGAAGGGGAGGGAGGAAGGG + Intronic
920117573 1:203631261-203631283 AGAGGAACTGGGGTGAGGAAAGG - Intronic
920478258 1:206297705-206297727 AGGAGAAAATGGGGGAGGAAGGG - Intronic
920512179 1:206559495-206559517 AGGAGAACTGGGGGGAAGAAGGG - Intronic
922008843 1:221560326-221560348 AGGAGATGTTGAGTGGTGAAGGG + Intergenic
923058451 1:230448096-230448118 ATGGGAAGTTGAGTGAGAAATGG - Intergenic
923284452 1:232478920-232478942 AGGATCACTTGAGATAGGAAAGG - Intronic
924533301 1:244911971-244911993 AGGAGAACATGAAGGAAGAATGG + Intergenic
1062784898 10:256202-256224 TGGAGAAGTGGAGTGAGGCAGGG - Intergenic
1064509784 10:16077331-16077353 AGGATCACTTGAGTGAGGTTAGG + Intergenic
1066546743 10:36508261-36508283 AGGAGAAAGTGAGTAAGTAATGG - Intergenic
1067011918 10:42722177-42722199 AGGAGAACTTGAAGGAAAAAAGG + Intergenic
1067311671 10:45119681-45119703 AGGAGAACTTGAAGGAAAAAAGG - Intergenic
1068701317 10:60023156-60023178 AGCATCACTGGAGTGAGGAAAGG + Intergenic
1068907594 10:62344309-62344331 AGGGGAACTTGAGAGATGACAGG - Intergenic
1070151758 10:73809610-73809632 AGAACAACTTGAGTAAGGACTGG + Intronic
1071115102 10:82208990-82209012 AGGAGAGCTTGAGAGAAGATAGG + Intronic
1073066781 10:100765323-100765345 GGGAGAACTTGAGGCAAGAATGG - Intronic
1073205523 10:101767401-101767423 AGGAGAATTGAAGTGAGGACTGG + Intergenic
1073370612 10:102985529-102985551 AGGAGAACATAAGTGAGACAGGG - Intronic
1073866497 10:107810370-107810392 AAGAGAAGATGAGAGAGGAAGGG - Intergenic
1075313872 10:121436707-121436729 AGGAAAACTCGAGTGAGCAGAGG + Intergenic
1076461076 10:130647906-130647928 AGGAGAACTGCACTGAGGCATGG + Intergenic
1076828028 10:132980026-132980048 GGGAGAGCATGAGTGTGGAAAGG + Intergenic
1077468163 11:2743533-2743555 GGGAGAACTTGAGCAGGGAAGGG + Intronic
1077673797 11:4180588-4180610 AAGAGAGCATGAGAGAGGAAGGG - Intergenic
1078892937 11:15573627-15573649 ATGGGAATTTGAGTAAGGAAGGG + Intergenic
1079456721 11:20642815-20642837 TGGAGAGCTTGACTCAGGAATGG + Intronic
1079874978 11:25845181-25845203 AGGGAAACTTGAGTGAAGGAGGG - Intergenic
1083990793 11:66244595-66244617 AGGAGAGCTTGGGGGAGGTATGG - Exonic
1084774298 11:71365156-71365178 AGGAAGGCTGGAGTGAGGAAGGG - Intergenic
1085758184 11:79218847-79218869 AGGGGAAATTGAGTTAGGAAGGG + Intronic
1086048466 11:82560911-82560933 AGGAGAACTTGAGGGAGTTAGGG + Intergenic
1086241677 11:84701389-84701411 AGGATAACTTGAATGAAGAAAGG - Intronic
1087560161 11:99779966-99779988 TGGACAATTTGAGTGTGGAAAGG - Intronic
1087805272 11:102548539-102548561 AGGAGAAATGGAGGGAGCAAGGG + Intergenic
1087973009 11:104508841-104508863 ATGAGAATTTGGGGGAGGAATGG + Intergenic
1088889161 11:114031168-114031190 AGGAGGACAAGAGTCAGGAAAGG - Intergenic
1088966523 11:114727635-114727657 AGCAAAACTTGAGTAAGGAGAGG - Intergenic
1089009634 11:115121938-115121960 AGGAGGGCTTGGGTGGGGAAGGG + Intergenic
1089772290 11:120812200-120812222 AGAACAGCTTGAGTGAGGGAAGG + Intronic
1090066673 11:123509816-123509838 AGGAAACCTAGAGTGATGAATGG + Intergenic
1090572385 11:128061454-128061476 AGAAGAACTTGAATGAGGCTGGG + Intergenic
1091407125 12:216001-216023 AGGAAAACTTGAGTGAGGAAGGG - Intergenic
1091407138 12:216096-216118 AGGAGAACTTGAGTGAGGAAGGG - Intergenic
1091407151 12:216191-216213 AGGAGAACTTGAGTGAGGAAGGG - Intergenic
1091407164 12:216286-216308 AGGAGAACTTGAGTGAGGAAGGG - Intergenic
1091407181 12:216381-216403 AGGAGAACTTGAGTGAGGAAGGG - Intergenic
1091407194 12:216476-216498 AGGAGAACTTGAGTGAGGAAGGG - Intergenic
1091407210 12:216571-216593 AGGAGAACTTGAGTGAGGAAGGG - Intergenic
1091658219 12:2361481-2361503 AGGAGAAATGAAGGGAGGAAGGG - Intronic
1091869972 12:3881291-3881313 AGGAGAGGGTGAGGGAGGAAGGG + Intergenic
1092166009 12:6342682-6342704 ATGAGACCTGGGGTGAGGAATGG - Intergenic
1092233324 12:6790045-6790067 AGGAGAAAAAGAGTGAAGAAGGG + Intronic
1092373174 12:7933986-7934008 AGGAGAATTTGAGTTATGAGTGG + Intronic
1092530289 12:9338487-9338509 AGGAGAAGTAGAGGGAGGAGAGG + Intergenic
1092630261 12:10368832-10368854 AGGAGAACTTGGGAAAAGAAAGG + Intergenic
1092925834 12:13271254-13271276 AGGAGAGCTTGAGAGAGGAAAGG - Intergenic
1093483675 12:19630078-19630100 AGGTGAAGTTGACTGAGGCACGG - Intronic
1094523714 12:31218450-31218472 AGGAGAAAGAGAGGGAGGAAAGG + Intergenic
1096769500 12:53925704-53925726 AAGCAAACTTGAGTGAGGGAAGG + Intergenic
1097179523 12:57163210-57163232 AGGGGAAACTGAGTGAAGAATGG + Intronic
1098098047 12:66981225-66981247 AGGAGAATTCGAGAGAGGAATGG - Intergenic
1099899138 12:88685255-88685277 AGGTGAATTTGAGTGGTGAAAGG + Intergenic
1099922547 12:88977452-88977474 AGGAAAACTCCAGAGAGGAAAGG - Intergenic
1101117040 12:101542121-101542143 GGGAGAATTGGAGTGAGGCAAGG - Intergenic
1101336018 12:103797596-103797618 AGGAGAAATTGGGAGGGGAAGGG - Intronic
1101792152 12:107937331-107937353 AGGAAAACTGAAGTGAGAAAAGG - Intergenic
1104235971 12:126936918-126936940 AGGAGAGCTGGAGAGAGGATGGG + Intergenic
1104522457 12:129487995-129488017 GGGAGAACTTTAGGGAGAAACGG + Intronic
1106253475 13:28001643-28001665 AGGACAACTTGCCTGTGGAAGGG - Intergenic
1106820106 13:33455319-33455341 AAGAGAATTTGAGAGAGGCAGGG + Intergenic
1107037110 13:35912973-35912995 AGGAGCATATGAGTGAGCAAGGG - Intronic
1107779980 13:43889292-43889314 AGGAGAATTTAGCTGAGGAATGG - Intronic
1108108253 13:47036872-47036894 ATGAGACCTAGACTGAGGAAGGG + Intergenic
1108195795 13:47993622-47993644 AGGAGAAGTTGAGTTAGCATGGG - Intronic
1109300479 13:60585475-60585497 AGGGGGACATGAGTGAGCAAAGG - Intergenic
1109478697 13:62919401-62919423 GGGAGAACCTGCCTGAGGAAAGG - Intergenic
1111575700 13:90151796-90151818 AAGAGAACTAGAGTTAGAAATGG - Intergenic
1112783081 13:102923360-102923382 AGGAGCACTGGAAGGAGGAAAGG - Intergenic
1112899327 13:104339785-104339807 TGAAGAATTTGGGTGAGGAATGG - Intergenic
1113675756 13:112206254-112206276 GAGAGAAATTGAGTGACGAAAGG + Intergenic
1114064230 14:19047050-19047072 AGCAGAACTTTGGTAAGGAAGGG - Intergenic
1114098029 14:19352948-19352970 AGCAGAACTTTGGTAAGGAAGGG + Intergenic
1114711655 14:24784748-24784770 ATGAGTGCATGAGTGAGGAAAGG + Intergenic
1114961718 14:27899906-27899928 AAGAGAAATTGAGAGATGAAAGG + Intergenic
1115157171 14:30354235-30354257 AGGAAACCTTAAATGAGGAAAGG + Intergenic
1116448476 14:45038930-45038952 AGGACAACTTGCGTGCAGAAAGG - Intronic
1117207268 14:53456647-53456669 TGGGGAGCTTGAGAGAGGAAAGG - Intergenic
1118089179 14:62453676-62453698 AGAAGAATTTGGGTGAGGATAGG + Intergenic
1118460645 14:65984083-65984105 AGGAGATCATGAGTGGGAAATGG + Intronic
1119044801 14:71309095-71309117 AGGAGCACATGAGTGATGGAGGG + Intergenic
1119931492 14:78551788-78551810 GGGAGAACTCCAGGGAGGAATGG - Intronic
1120743988 14:88137471-88137493 TGGAGAGCCTGAGTGTGGAAGGG - Intergenic
1121067961 14:90986895-90986917 AGGAGAACAAGAGTGAGGGAAGG - Intronic
1121928622 14:97951773-97951795 TGGAGGAGTTGAGAGAGGAAAGG - Intronic
1122109134 14:99483236-99483258 AGCAGAGCTTCAGTGAGAAAAGG + Intronic
1122914868 14:104854234-104854256 AGGAGCAGTGGAGGGAGGAATGG + Intergenic
1123492386 15:20792127-20792149 AGCAGAACTTTGGTAAGGAAGGG + Intergenic
1123548888 15:21361209-21361231 AGCAGAACTTTGGTAAGGAAGGG + Intergenic
1123829861 15:24124172-24124194 AGGTGAACTTGGGTTTGGAAAGG - Intergenic
1124382539 15:29178611-29178633 AGGGGAAGTTGGGTGAGCAAAGG - Intronic
1125023203 15:35005288-35005310 TGGAGAACTTGTGTGAGAATGGG - Intergenic
1125324449 15:38522727-38522749 TTGAGAAGTTCAGTGAGGAAGGG + Intronic
1125492103 15:40155897-40155919 AGGGGAACTTGAAAGAGGATGGG - Intergenic
1125584801 15:40812825-40812847 AGGAGAACACGAGGCAGGAACGG + Exonic
1125974529 15:43939355-43939377 GGGAGATCTGGAGTGTGGAAAGG - Intronic
1126685116 15:51241609-51241631 AGGAGAAATCCAGTGAGGAAGGG + Intronic
1127564649 15:60175328-60175350 GGGAGAAATTCACTGAGGAATGG - Intergenic
1128047237 15:64629337-64629359 AGGAAACATTGAGTTAGGAATGG + Intronic
1128052238 15:64674623-64674645 AGAAAAAGTTGAGTGGGGAAGGG + Exonic
1128154312 15:65383255-65383277 AGGAAAACAGGAGAGAGGAAAGG + Exonic
1128306323 15:66601229-66601251 AGGAGATCTTGAGGGAGAATTGG - Intronic
1128385475 15:67145088-67145110 AGGAGAACGTGACTGAACAATGG - Intronic
1128562154 15:68676006-68676028 AGGAGAAATTGATTAGGGAAGGG + Intronic
1128915322 15:71554964-71554986 AGGAGGACATGAGTGGGGAGTGG - Intronic
1129275930 15:74445291-74445313 AGGGGAACATGAGTGAGCACAGG + Intergenic
1129316164 15:74746015-74746037 AGGATCACTTGAGTGAGGCCAGG - Intergenic
1131393675 15:92069735-92069757 AGCAGAGCTCGAGTGAGGGATGG - Intronic
1131424672 15:92335741-92335763 ATGAGAACTTGAGGGAGCAATGG - Intergenic
1132265813 15:100469853-100469875 AGGAGAACTGGACTGAAGAAAGG + Intronic
1202957224 15_KI270727v1_random:88448-88470 AGCAGAACTTTGGTAAGGAAGGG + Intergenic
1133920617 16:10149739-10149761 AGGAGTTCTGGAGTGAGGAGGGG - Intronic
1134025348 16:10949011-10949033 AAGGGAATATGAGTGAGGAATGG - Intronic
1135997170 16:27259217-27259239 AGAAGGACTTGGGAGAGGAAAGG - Intronic
1137039606 16:35598865-35598887 AGGAGAACTTGGGAGAAGAAAGG - Intergenic
1138255658 16:55556848-55556870 AGGAGGATTTGAGTGGGGAAGGG + Intronic
1138799389 16:60008786-60008808 AGGACAGCTTGAGTGCTGAATGG + Intergenic
1139363951 16:66422075-66422097 AGGAGCACTGGTGTGGGGAAGGG - Intergenic
1140150358 16:72357019-72357041 AGGAGAACTGGACAGAAGAATGG + Intergenic
1140632670 16:76872899-76872921 AGGAGATCTACAGTGGGGAATGG + Intergenic
1143307757 17:5961104-5961126 AGAAGGATTTGGGTGAGGAAGGG - Intronic
1143432625 17:6898361-6898383 AGGAGAGCTTGGGGGAGGAATGG - Intronic
1143601040 17:7946190-7946212 ATGAGAACTGGAGTTGGGAACGG + Intronic
1143852951 17:9826214-9826236 AGCAGGACCAGAGTGAGGAAGGG - Exonic
1146013231 17:29212382-29212404 AGGAGGATTTGAATAAGGAAAGG - Intergenic
1147259823 17:39202963-39202985 TGGAGAAGATGAGTTAGGAACGG - Intronic
1147632521 17:41941283-41941305 AGGAGAAGTCAAGTGAAGAAGGG - Intronic
1147755139 17:42762564-42762586 AAGAGGACTTGAGTGAGAGAGGG - Intronic
1148037561 17:44679099-44679121 AGGATAAGTAGAATGAGGAAAGG - Intronic
1148355426 17:46972407-46972429 AGGAGAACCTGGGACAGGAAAGG + Intronic
1148405610 17:47411771-47411793 GGGAGAAATTGATTGAGAAATGG + Intronic
1148858765 17:50593289-50593311 AGGAGGAGCTGAGTGAGGACCGG + Intronic
1150509803 17:65738891-65738913 AGGAGAAATAGTGGGAGGAATGG - Intronic
1152125701 17:78445245-78445267 AGGAGAGGTTGAGGGAGGGATGG + Intronic
1152405669 17:80096596-80096618 TGGAGAACTTGAGTGTGGCTTGG - Intronic
1152936705 17:83142423-83142445 AGGAGAATGTGGATGAGGAAGGG + Intergenic
1153013670 18:564187-564209 AGGATAACTGGAGTGGGGAGAGG + Intergenic
1154213000 18:12395929-12395951 AGGAGAAGTAGAGTGTGCAAAGG + Intergenic
1154291829 18:13115406-13115428 AGGAGAAGTTCAGTGTGAAAGGG + Intronic
1154449929 18:14466674-14466696 AGCAGAACTTTGGTAAGGAAGGG + Intergenic
1155829533 18:30495630-30495652 AAGAGAACTTCAGTGATTAAAGG + Intergenic
1156149696 18:34226514-34226536 AGGAGAACAAGAGTAAGGGAAGG + Intergenic
1156245384 18:35292697-35292719 AGAAGATCTAGAGTGAGAAAAGG - Intergenic
1156294942 18:35781045-35781067 AGGATACCTTGAGTCAGGACTGG - Intergenic
1158513369 18:58110716-58110738 ACAAAAACTTGAGTCAGGAAGGG - Intronic
1159246139 18:65807882-65807904 AGGGGAACTTGAGGAAAGAAGGG - Intronic
1159685192 18:71410282-71410304 AGGAAGAATTAAGTGAGGAAGGG + Intergenic
1159865971 18:73705678-73705700 GGGAGAACTGGAGAGAGAAAGGG - Intergenic
1161630357 19:5351830-5351852 AGGAGGACTAAAGTGAGGACAGG + Intergenic
1161845253 19:6708499-6708521 AGGAGGAATGGAGGGAGGAAGGG - Intronic
1161873235 19:6886782-6886804 AGGAGAAAGTGAATCAGGAAAGG - Intergenic
1162996648 19:14340045-14340067 GGGAGAAGGAGAGTGAGGAAGGG - Intergenic
1163190619 19:15674100-15674122 AGGAGTGAGTGAGTGAGGAAAGG - Intronic
1163202466 19:15778666-15778688 GGGAGTACGTGAGTGAGGAGGGG + Intergenic
1163202483 19:15778798-15778820 AGGAGTGCGTGAGTGAGGAGAGG + Intergenic
1163202499 19:15778926-15778948 AGGAGTGCGTGAGTGAGGAGGGG + Intergenic
1163202544 19:15779258-15779280 AGGAGTGCGTGAGTGAGGAGAGG + Intergenic
1163584515 19:18156540-18156562 AGGAGGACCAGAGGGAGGAAGGG + Intronic
1164771864 19:30815918-30815940 AGGAGAAAAGGAGGGAGGAAAGG - Intergenic
1164777116 19:30861605-30861627 AGGAGAAATCGAGTGAAGGAAGG + Intergenic
1165029020 19:32983953-32983975 AGGTGGATTTGAGTGAGGAATGG - Intronic
1166964748 19:46522272-46522294 AGGAAAGCTTGAGGAAGGAATGG + Intronic
1168392957 19:56025825-56025847 AGGGGAACTTGAGGGAGCCACGG - Intronic
925091325 2:1158243-1158265 ACATGAACTTGAGTGAGTAAAGG - Intronic
925178596 2:1801979-1802001 AGGGGAACTTAGGTGGGGAAGGG - Intronic
925415963 2:3670425-3670447 AAGAGACCGTGAGGGAGGAAGGG - Intronic
926327883 2:11800673-11800695 AGGAGATCTTAAGGGAGGCAGGG + Intronic
926574245 2:14562850-14562872 AGGAGAACTTGAGATGGCAAAGG + Intergenic
927650912 2:24913257-24913279 AGGAGTACTTGAGAAAGGCAGGG - Intronic
929277061 2:40037303-40037325 ACGAGAGGTTGAGGGAGGAAAGG + Intergenic
929749839 2:44699050-44699072 AAGAGAACTAGAATGAGAAATGG - Intronic
929797635 2:45072325-45072347 AGGAGAACCTGAGTGGGAACAGG + Intergenic
930059609 2:47277256-47277278 AGGAGGACTTGTGTGAGGCCTGG - Intergenic
931733849 2:65176963-65176985 AGGACAACTTGCCTGTGGAAAGG - Intergenic
931810369 2:65848964-65848986 GGAAGAACTTGAGTAAGGGATGG + Intergenic
932373715 2:71215485-71215507 AGAAGAGTTTGAGTGAAGAAGGG - Intronic
932705207 2:74019459-74019481 ATGAGGACTTGAGGGAGAAAGGG - Intronic
935352687 2:102167389-102167411 AGTAGAACTTGAGAGAGAACTGG + Intronic
935556400 2:104513977-104513999 AGGAGGACATGAGTTTGGAAGGG + Intergenic
937483358 2:122287207-122287229 AGGAGAACTTGGCTAAGGCAGGG + Intergenic
938771980 2:134508556-134508578 AGGAGAAAGTGAGCAAGGAATGG + Intronic
939314317 2:140528248-140528270 AGGATAACTTGAGAGAAGAGTGG + Intronic
939415828 2:141895534-141895556 AGCAGAACATTAGTGAGGACTGG + Intronic
940496077 2:154430409-154430431 AGGAGAACTAGAATTAGGAGTGG + Intronic
941210335 2:162629636-162629658 TGGAGAGCTTGTGTGAGCAAAGG - Intronic
941647603 2:168057953-168057975 AGGAAAAATTGAATGAGGGAGGG - Intronic
942524507 2:176839031-176839053 AGGAGATATTGAGAGAGAAAGGG + Intergenic
942553418 2:177145320-177145342 GGGAGAAGGGGAGTGAGGAAAGG + Intergenic
942805136 2:179922136-179922158 AGGATAACTTGAGTCAGGGGAGG - Intergenic
944373651 2:199014300-199014322 AGGAGAATTTAAGCGAGGGAAGG - Intergenic
944871137 2:203913147-203913169 ACGAGAACCAGAGTCAGGAAAGG - Intergenic
946172997 2:217906320-217906342 AGGACAACGTGAGTGTGGATGGG - Exonic
946811538 2:223530775-223530797 AGGAGAGCTGGAGAGAGGATGGG - Intergenic
947489740 2:230583312-230583334 AGGAGACCTTCAGTGAGAAGCGG - Intergenic
947520525 2:230842580-230842602 AGGAGAACAGGAGTTAGGGAGGG - Intergenic
948602549 2:239115650-239115672 AGGAGAGCTTGAGTGTGAAGGGG + Intronic
948655673 2:239475520-239475542 AGGAGAACATGGGTGAGAACTGG - Intergenic
1172549560 20:35788457-35788479 AGGATCACTTGAGTGAGGCCAGG - Intronic
1172645487 20:36466588-36466610 AGCACAGGTTGAGTGAGGAAAGG - Intronic
1172681875 20:36722608-36722630 ATGAGGACTTGAATTAGGAATGG + Intronic
1173187509 20:40852035-40852057 AGAAGGACTTGAGAGAGAAAGGG + Intergenic
1173605654 20:44329438-44329460 AGGAGAAATTCAGTGAGATATGG - Intergenic
1174132857 20:48358379-48358401 AGGAGAAGTTTATTGAAGAATGG - Intergenic
1174638649 20:52023851-52023873 AGGTGACCTTGAGAGAGGACAGG - Intergenic
1176446248 21:6823678-6823700 AGCAGAACTTTGGTAAGGAAGGG - Intergenic
1176824417 21:13688708-13688730 AGCAGAACTTTGGTAAGGAAGGG - Intergenic
1178223025 21:30682729-30682751 AGGATTACTAGAGTGGGGAAGGG - Intergenic
1178662247 21:34517582-34517604 ATGAGAACATGAGGGAAGAAAGG + Exonic
1179968515 21:44820205-44820227 TGGAGAAGTTAAGAGAGGAAAGG + Intergenic
1181369680 22:22406003-22406025 AGGAGAGCTTGTGTGGGGGAGGG + Intergenic
1181411926 22:22730201-22730223 AGCAGAACTGGAGGGAGGAAAGG - Intergenic
1182318206 22:29461844-29461866 AGGAGAAAGGGAGTCAGGAAAGG + Intergenic
1183615706 22:38944074-38944096 AGGAGAAGGAGAGGGAGGAAGGG - Intergenic
1184251237 22:43261493-43261515 AGGAGACCATGAGTTGGGAAAGG + Intronic
950600738 3:14033179-14033201 AGGACAACTTGAGGCAGGAAGGG + Intronic
950910580 3:16585652-16585674 AAGAGAATTTTAGTGAAGAAGGG + Intergenic
951761703 3:26154668-26154690 AGGAAAACTTGAGGGAGCAATGG + Intergenic
951979386 3:28548771-28548793 AGGAGAGAGTGAGAGAGGAAGGG + Intergenic
952580919 3:34832510-34832532 AGGAAAAGGGGAGTGAGGAAAGG + Intergenic
952991751 3:38836575-38836597 TGGAGAACTTGAGGGATGACAGG + Intergenic
953110769 3:39935805-39935827 AGGAGCACTTGGGAGAGAAATGG + Intronic
955073806 3:55593885-55593907 AGGAATACTTGAGAGAAGAAGGG - Intronic
955119408 3:56041595-56041617 AGGAGAAAGTGAGAGAGGAAAGG - Intronic
955353250 3:58209588-58209610 AGGAGGATTGGAGTGAGGACTGG - Intronic
955896437 3:63705685-63705707 AGGAGAAATGGTGTGAGCAAAGG + Intergenic
959487777 3:106948142-106948164 AAGAGAAAGTGAGAGAGGAAAGG + Intergenic
960378866 3:116935560-116935582 AGGCGAAGATGGGTGAGGAAAGG - Intronic
961155904 3:124679362-124679384 AGGAGAACTTCAGAGAAGCATGG - Intronic
961362855 3:126379033-126379055 ATGAGAAGGTGAGTGAGAAAAGG - Intergenic
961492929 3:127267771-127267793 AGGATAGCTTGAATGGGGAAGGG - Intergenic
963525841 3:146412533-146412555 AGGAGTACTTCAGTGAGGTATGG + Intronic
964138348 3:153369923-153369945 GTGAGAATTTGAGTGAGGCACGG + Intergenic
964508180 3:157422017-157422039 AGGAGAAGGTGAGGGAGAAAGGG - Intronic
965264905 3:166531062-166531084 AGGAGAATTAGAGTGAAGAGGGG + Intergenic
965746893 3:171935520-171935542 TGGAGAACTTGGCTGAGGAACGG - Intronic
966647467 3:182262640-182262662 AGGAGAACTAATCTGAGGAAAGG + Intergenic
966818362 3:183906905-183906927 CGGAGTGCATGAGTGAGGAATGG - Intergenic
967398771 3:189037073-189037095 AGGACAACTTGTATGAGGAAAGG - Intronic
967514975 3:190357467-190357489 AGAGGAACTAGAATGAGGAAAGG - Intronic
968986989 4:3880852-3880874 AGGAGAAATTGAGGGAGGAGAGG + Intergenic
969305959 4:6326455-6326477 AGGAGAACTTCATGGAGGAGGGG + Intronic
969501803 4:7558051-7558073 AGGAGGTGTTGAGTGAGGAGGGG + Intronic
969728842 4:8941290-8941312 AGGAGAAATTGAGGGAGGAGAGG - Intergenic
972443413 4:39118826-39118848 ATGAGAATTTGAGTGTAGAAAGG + Intronic
973119241 4:46498650-46498672 AGGAAAACTTGAGAGAAAAATGG - Intergenic
973716670 4:53683663-53683685 AGGACAATGTGAGTGTGGAAGGG + Intronic
973945047 4:55947177-55947199 AGGATAACCTGATTGGGGAATGG - Intergenic
974235960 4:59181079-59181101 AGTGGAGCTTGAGTCAGGAAGGG + Intergenic
975405367 4:73982315-73982337 AACAGAACTTGAGTCAGAAAAGG + Intergenic
975475875 4:74822772-74822794 GGGAGAATATGAGAGAGGAAGGG - Intergenic
976334528 4:83870414-83870436 AGGAGAATTTGGGTGAGGCCTGG - Intergenic
977121350 4:93105665-93105687 AAGAGATCTTGAGTGAAGAAAGG - Intronic
978575257 4:110183339-110183361 AGGACAACTTGAATTAGGGAGGG - Intronic
978722623 4:111929894-111929916 AGGAGAACTGGAGAGAAAAAAGG - Intergenic
979089870 4:116468994-116469016 AGCAGAAATTGAATGTGGAAAGG + Intergenic
979210625 4:118097163-118097185 ATGAGAACTTGAATGAGCTATGG - Intronic
979741472 4:124156267-124156289 TTAAGAACTTGAATGAGGAAAGG - Intergenic
979924773 4:126547567-126547589 AGGAGGACTTGGATGAGGATAGG - Intergenic
981294763 4:143118982-143119004 AGGAGTCCTAGAGAGAGGAAGGG - Intergenic
981390267 4:144181916-144181938 AGGAGACCTGGAGATAGGAAAGG + Intergenic
981436703 4:144732073-144732095 AGAAAAACTTCAGTGAAGAAGGG + Intronic
985033258 4:185813495-185813517 AAGGGAACTTCAGTGAGAAAAGG - Intronic
985245877 4:187979316-187979338 GGGAGAACAGGAGTTAGGAAAGG - Intergenic
985312996 4:188624040-188624062 ATCAGAACTTGAGGGAGCAAGGG - Intergenic
986051762 5:4096808-4096830 AGGAGAGCCTGAGTCTGGAAAGG + Intergenic
986781936 5:11074669-11074691 TGGAGAACTGGAGTGAGGGGTGG - Intronic
987025911 5:13926189-13926211 AGGAGCACCTGAGGGAGGATGGG + Intronic
987229430 5:15878088-15878110 AGGACAACGTGAGTGTGAAAAGG + Intronic
988120763 5:26958118-26958140 AAGAATACTTGAGTGAGGAATGG + Intronic
989734458 5:44687227-44687249 AGGAGAATCTGAGCTAGGAATGG - Intergenic
989997431 5:50852648-50852670 AAGAGAAACGGAGTGAGGAAAGG - Intergenic
991234208 5:64375467-64375489 AAGACAAGTTGACTGAGGAAGGG + Intergenic
994776267 5:104038714-104038736 AGGACAACTTGAAGCAGGAAGGG - Intergenic
995503329 5:112832665-112832687 AGGGGAAGTAGAATGAGGAAAGG - Intronic
995789891 5:115875287-115875309 AAGAATACTTAAGTGAGGAAAGG + Intronic
996837816 5:127813250-127813272 AAGAGAATTTGAGAGTGGAAAGG - Intergenic
998023188 5:138789093-138789115 AGGGAAATATGAGTGAGGAATGG + Intronic
998460586 5:142307142-142307164 AGGAGAAGGTGGGAGAGGAAGGG + Intergenic
998680075 5:144457372-144457394 AGGGGCACTGGAGTTAGGAATGG + Intronic
998762934 5:145452481-145452503 AGGACAGCTTCAGGGAGGAAAGG - Intergenic
999090501 5:148931904-148931926 AGGAGAAAGAGAGAGAGGAAAGG - Intronic
999103418 5:149047094-149047116 AGGAGAACTAAAGTCAGAAATGG - Intronic
999282624 5:150375276-150375298 AGGAGAATGTGAGTGAGGGGAGG - Intronic
1000012342 5:157244581-157244603 GGGAGAAGTTGAGAAAGGAAAGG - Intronic
1000125773 5:158242402-158242424 GGGAGAAGATGAGTGAGAAATGG + Intergenic
1002077000 5:176714249-176714271 AGGAGGAGATGAGTCAGGAAGGG - Intergenic
1004903010 6:20211234-20211256 AGGAGCACTGGTGAGAGGAAGGG + Intronic
1005419128 6:25630997-25631019 GGGAGAGGTGGAGTGAGGAAGGG + Intergenic
1005675717 6:28152812-28152834 AGGGGAACTAAAGTCAGGAAAGG - Intronic
1006767217 6:36518035-36518057 ATGAAAACTTGAGTGATGAAAGG + Intronic
1008456924 6:51721836-51721858 AGAAGAAATTGATTGAGGACTGG - Intronic
1009461576 6:63920283-63920305 AGGAGATCTTAGGGGAGGAATGG - Intronic
1010552256 6:77237441-77237463 AGGATAACTGCATTGAGGAAAGG + Intergenic
1010928604 6:81773291-81773313 AGGAAATGTTGAGGGAGGAAAGG - Intergenic
1011380624 6:86738805-86738827 AGGATCACTTGAGTGAGGCCAGG + Intergenic
1011506003 6:88044945-88044967 AGAAGACCTTCAGTGAGGTAGGG + Intergenic
1012382617 6:98638284-98638306 AAGAGAGCCTGAGTGAGCAAAGG - Intergenic
1012462696 6:99481654-99481676 GGGAGAGATTGAGGGAGGAAGGG - Intronic
1013056680 6:106589970-106589992 AGGAGAACTTGACAGACGGAAGG - Intronic
1013354698 6:109336534-109336556 AGAAGAACTGCAGTGGGGAATGG + Intergenic
1014480217 6:121927196-121927218 TGGAGGAATTAAGTGAGGAAAGG - Intergenic
1015114088 6:129627617-129627639 AGGAAAAATAGAGAGAGGAAGGG + Intronic
1015366488 6:132401952-132401974 AGGAGGAATTGAGTGAGCAAAGG + Intergenic
1016352319 6:143181720-143181742 AGGAAAACTGGAGGGAGAAAGGG + Intronic
1016919578 6:149278727-149278749 AGGAGAAGTAGAGGAAGGAAGGG + Intronic
1017460780 6:154647582-154647604 AGGGGAACTTGTGGGAGTAATGG + Intergenic
1017515123 6:155149357-155149379 CTGGGAACTTGAATGAGGAATGG + Intronic
1017556396 6:155575698-155575720 AGGAGAATATGAGAGAAGAAAGG - Intergenic
1018347746 6:162920189-162920211 AGGAGGAAGTGAGGGAGGAAGGG + Intronic
1020754126 7:12180455-12180477 AGGAGATCTGGAGTTAGAAATGG - Intergenic
1020800949 7:12731434-12731456 AAGTGAACTTGAGTCAGGCAGGG + Intergenic
1021551902 7:21879733-21879755 TGGAAAACTTGAGTTAGGTATGG - Intronic
1021791949 7:24214842-24214864 AGGATAACTGGGGTGATGAATGG + Intergenic
1022721825 7:32948451-32948473 AGAAGAACTTTATTGAGCAATGG - Intergenic
1023948627 7:44823530-44823552 AGGAGAGATTGAGAGAGGGAGGG - Intronic
1024157361 7:46638942-46638964 AGCAGAACTTCACTGTGGAAGGG - Intergenic
1024603005 7:51001698-51001720 AGGGGAAAGTGAGTCAGGAAAGG - Intergenic
1024955571 7:54915714-54915736 AGTAGAACTGGCCTGAGGAAAGG - Intergenic
1026128356 7:67599061-67599083 TGGGGAAATTGAGTGAGGACTGG + Intergenic
1026799658 7:73391670-73391692 AGGGGACCTTTAGTGTGGAATGG + Intergenic
1028549708 7:92046310-92046332 AGAAGTGCTTGAGTGTGGAATGG - Intronic
1029170840 7:98628082-98628104 AGGGGAAATTGAGGGAGGAGTGG - Intronic
1029479618 7:100804661-100804683 AGGAGATCTTGGGAGAGGAACGG + Intronic
1029812981 7:103068087-103068109 AGAAGGACATGACTGAGGAACGG + Intronic
1030021202 7:105276951-105276973 AGGAGAAGTAGAGTTAGGATGGG - Intronic
1030065970 7:105659536-105659558 AGGAGGAAGTGAATGAGGAAAGG + Intronic
1030200008 7:106892972-106892994 AGTAGAATTTGAGTCAAGAAAGG + Intronic
1030224397 7:107132700-107132722 GGGAAAACTTGAAGGAGGAAGGG + Intronic
1030521096 7:110599102-110599124 AAGAGAAATTGGGTGAAGAATGG - Intergenic
1032109873 7:129066839-129066861 AGGAGAAGTTGAGTCAGGAGAGG - Intergenic
1033798403 7:144874097-144874119 ATGAGAACAGGAGAGAGGAAGGG - Intergenic
1033886163 7:145948888-145948910 AGGAGAATGTGAGTAAGGGAGGG + Intergenic
1034210920 7:149361782-149361804 AGGAGAACTAGAATTAGGAGGGG + Intergenic
1035326554 7:158069785-158069807 TGGACATCTTGAGTGAGCAATGG + Intronic
1035463499 7:159061186-159061208 AGGAGAAATGGAGGGAGAAACGG + Intronic
1035494184 7:159307645-159307667 ATGAGAATTGGAGTGAGGACGGG + Intergenic
1035620046 8:1029695-1029717 GGGTGACCTTGACTGAGGAATGG + Intergenic
1035622365 8:1043602-1043624 AGGAGGACTGCAGTGGGGAAGGG + Intergenic
1036064971 8:5369652-5369674 ATGAGAAATTGAGTGAAAAAAGG - Intergenic
1036917044 8:12814242-12814264 AGCAGAACTTGAGGGCTGAAGGG - Intergenic
1038926982 8:32151563-32151585 GGGAAAACTTGAGTGGTGAACGG + Intronic
1040361991 8:46674361-46674383 GAGAGAACTAGAGGGAGGAAGGG + Intergenic
1041173708 8:55171626-55171648 AAGACAACTTGTGGGAGGAAGGG - Intronic
1041246971 8:55897501-55897523 AGGAGAAATTGAGGTAGAAAAGG - Intronic
1041884481 8:62792663-62792685 AGGAAAAGTGGATTGAGGAAGGG + Intronic
1042939366 8:74091844-74091866 AGGAAGGCTTGAGGGAGGAAGGG - Intergenic
1043708001 8:83377917-83377939 AGAACAACTTGCGTGGGGAAAGG - Intergenic
1045251523 8:100487044-100487066 AGGGGAACAGGAGTGTGGAAGGG - Intergenic
1045285667 8:100789229-100789251 TGGAGAAAATGAGGGAGGAAAGG + Intergenic
1045913131 8:107434058-107434080 AGGCAAATTTGATTGAGGAAAGG + Intronic
1045937955 8:107704691-107704713 AGGATAAATTGAGTTGGGAAAGG - Intergenic
1046999251 8:120557164-120557186 AGAAGATTTTGTGTGAGGAATGG + Intronic
1048111781 8:131475195-131475217 ATGAGAGCTTGAGAGTGGAAGGG - Intergenic
1048488231 8:134868216-134868238 TGGAGAGCTTGAGAGGGGAAGGG + Intergenic
1049142060 8:140963850-140963872 AGGAGAACTTGAGGGGGGTTAGG + Intronic
1049422531 8:142523290-142523312 AGAAGAACTGGGGTGGGGAAGGG + Intronic
1049643319 8:143725182-143725204 AGGAGACCTTGAGAGAGGGAGGG + Exonic
1050892172 9:10837195-10837217 AGGACAACTTGGGTGGGGCACGG + Intergenic
1051638222 9:19200766-19200788 AGGAGAACTGGAGAAAGGAAGGG - Intergenic
1051863506 9:21652416-21652438 AGAAGAAGTTGAATGAGTAAAGG + Intergenic
1052346159 9:27411909-27411931 AGGGGAAATTGTGGGAGGAAGGG + Intronic
1053102256 9:35380887-35380909 AGGAGAACAGGAGTGTGGAGGGG - Intronic
1053365796 9:37521672-37521694 AAGAGAACTTCAGCGAGGATGGG - Exonic
1056061866 9:82891586-82891608 AGGAGTCCTTGAGTGCTGAAGGG - Intergenic
1057727687 9:97579806-97579828 ATGTGCACTTGAGTGTGGAATGG + Intronic
1058100052 9:100909249-100909271 AGGAGAACTAGAGAGAGGGAAGG - Intergenic
1059411529 9:114135529-114135551 AGGAGAAATGGAGAGAGGCATGG - Intergenic
1059808277 9:117828217-117828239 AAGAGAAATTGAGAAAGGAATGG + Intergenic
1059982804 9:119791910-119791932 GGAAGAACTTGACTGAGCAAAGG + Intergenic
1060825556 9:126685711-126685733 AGGAGATCTTGACTCAGCAAGGG + Intronic
1061304859 9:129726326-129726348 AAAAGAACTTGAGAGAGAAAGGG + Intergenic
1061675013 9:132210702-132210724 AGGGGAAGTTGAGTGGGGAGAGG + Intronic
1061728127 9:132592491-132592513 AGGAGAACTTTAGGGAAGAGGGG - Intergenic
1062466111 9:136682361-136682383 AGGGGAGTTTGAGTGAGGCAGGG - Intronic
1203522942 Un_GL000213v1:60852-60874 AGCAGAACTTTGGTAAGGAAGGG + Intergenic
1185603593 X:1354960-1354982 AGGAGGACTGGGGGGAGGAAGGG + Intronic
1185824863 X:3240495-3240517 AGGAGAAAGGGAGGGAGGAAAGG - Intergenic
1185936016 X:4257700-4257722 AGGACAACTTGCCTGTGGAAAGG + Intergenic
1187132266 X:16514219-16514241 AGGAGAGAATGAGAGAGGAAAGG + Intergenic
1188095720 X:26018776-26018798 AGGAGAAAGTGAAGGAGGAAAGG - Intergenic
1188447544 X:30271845-30271867 TGGAGGACTTGAGAGTGGAAGGG - Intergenic
1188844980 X:35061275-35061297 AGGGCAACTGGAGGGAGGAAAGG + Intergenic
1189857611 X:45239025-45239047 AGGGGAAATAGAGTAAGGAAGGG - Intergenic
1194131107 X:90083678-90083700 AGGAGAACATGATTGAGTCATGG - Intergenic
1194350762 X:92823145-92823167 AGGAGAACTTGAGGCAGGTTGGG + Intergenic
1195605746 X:106803503-106803525 GGGAGAACTGGAGTCAGGAGAGG + Intronic
1196015337 X:110933942-110933964 AGGTGCACCTGACTGAGGAAAGG - Intergenic
1196118670 X:112024668-112024690 AGCACAACTTGACTGTGGAAGGG - Intronic
1196840179 X:119852672-119852694 AGGAGAACCTGAGAAAGAAAGGG + Intronic
1198416661 X:136427049-136427071 AGGAGAATTTGAGTGAAGTGTGG + Intergenic
1198437465 X:136631021-136631043 AGGGCATCCTGAGTGAGGAAAGG - Intergenic
1198520145 X:137444303-137444325 AAGAGAACTTGAGGCAGGCATGG - Intergenic
1199973632 X:152878351-152878373 CTGAGAACAGGAGTGAGGAAGGG + Intergenic
1200659089 Y:5939825-5939847 AGGAGAACTTGAGGCAGGTTGGG + Intergenic