ID: 1091407196

View in Genome Browser
Species Human (GRCh38)
Location 12:216481-216503
Sequence AGGCTAGGAGAACTTGAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 6, 1: 1, 2: 1, 3: 15, 4: 169}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091407196_1091407198 -8 Left 1091407196 12:216481-216503 CCTCACTCAAGTTCTCCTAGCCT 0: 6
1: 1
2: 1
3: 15
4: 169
Right 1091407198 12:216496-216518 CCTAGCCTCCAAGACCCACTTGG 0: 7
1: 0
2: 1
3: 11
4: 164
1091407196_1091407204 19 Left 1091407196 12:216481-216503 CCTCACTCAAGTTCTCCTAGCCT 0: 6
1: 1
2: 1
3: 15
4: 169
Right 1091407204 12:216523-216545 CAGACTGGTTAGTAAACCCCTGG 0: 1
1: 3
2: 2
3: 6
4: 91
1091407196_1091407201 4 Left 1091407196 12:216481-216503 CCTCACTCAAGTTCTCCTAGCCT 0: 6
1: 1
2: 1
3: 15
4: 169
Right 1091407201 12:216508-216530 GACCCACTTGGTGTTCAGACTGG 0: 2
1: 2
2: 1
3: 5
4: 56
1091407196_1091407205 22 Left 1091407196 12:216481-216503 CCTCACTCAAGTTCTCCTAGCCT 0: 6
1: 1
2: 1
3: 15
4: 169
Right 1091407205 12:216526-216548 ACTGGTTAGTAAACCCCTGGAGG 0: 1
1: 2
2: 1
3: 5
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091407196 Original CRISPR AGGCTAGGAGAACTTGAGTG AGG (reversed) Intergenic
901430777 1:9213337-9213359 AGGGGAGGAGCACTAGAGTGGGG - Intergenic
905369988 1:37477730-37477752 AGGCAAAGAGAACTGGAATGGGG + Intronic
905445696 1:38027339-38027361 ACGCTGGGAGAACTTGAGCGGGG - Intergenic
907902846 1:58756991-58757013 AGGCAAGGAAAACATGTGTGTGG + Intergenic
909206058 1:72759245-72759267 AGACTGGGAGAACTGAAGTGTGG - Intergenic
911969261 1:104409213-104409235 AAGCTATGAGATCTTGAGTTTGG - Intergenic
914690464 1:150021321-150021343 AGGCTGGGAGGACTGGAGTCAGG + Intergenic
918078130 1:181185801-181185823 AGGCAAGCAGAACGTGAGGGTGG - Intergenic
918210166 1:182343326-182343348 AGGCTAAGAGAAATCGAGAGAGG + Intergenic
918362913 1:183777398-183777420 GAGCTAGGACAACTTGAGTTTGG + Intronic
920397920 1:205660078-205660100 AGGTTAGGAGAGCCTGCGTGGGG - Intronic
921802356 1:219416077-219416099 ATAATAGGAGAAATTGAGTGTGG - Intergenic
924199618 1:241645492-241645514 AGGCCTGGAGAACTTCTGTGAGG + Intronic
1063204291 10:3815944-3815966 AGGTGAGGAGGACTTGAGGGTGG + Intergenic
1067272001 10:44799823-44799845 AGGAAAGGAGAACAGGAGTGGGG + Intergenic
1068065646 10:52127288-52127310 AGGTTAGGAGAAAATGAGTTAGG + Intronic
1069956174 10:72053374-72053396 AGGCTTGGAGAAATTGAGTTAGG - Intergenic
1072739627 10:97901610-97901632 GGGCATGGAGAACTTGGGTGAGG + Exonic
1075431961 10:122392573-122392595 AAGATAGGAGATCTAGAGTGCGG + Intronic
1078437790 11:11339752-11339774 AGGAGAGGGGAACTTGAGTTGGG - Intronic
1080806878 11:35662333-35662355 AGGCTAGGGGAATTGGAGTTAGG - Intergenic
1083430218 11:62610535-62610557 AGGGTAGGGGAACTGGAGTCAGG + Intronic
1084982981 11:72842147-72842169 AGTCTAGGGTCACTTGAGTGGGG + Intronic
1086202847 11:84224183-84224205 ATGCTAGAAGAAGTTGAGAGCGG + Intronic
1086916768 11:92538876-92538898 AGCCTCTGAGAACATGAGTGAGG + Intronic
1090131222 11:124144458-124144480 AGACTAGGAGAACAAGCGTGGGG + Intronic
1090319412 11:125829430-125829452 AGCCTAGGAGAACTGTGGTGTGG + Intergenic
1091407127 12:216006-216028 AGGCTAGGAAAACTTGAGTGAGG - Intergenic
1091407140 12:216101-216123 AGGCTAGGAGAACTTGAGTGAGG - Intergenic
1091407153 12:216196-216218 AGGCTAGGAGAACTTGAGTGAGG - Intergenic
1091407166 12:216291-216313 AGGCTAGGAGAACTTGAGTGAGG - Intergenic
1091407183 12:216386-216408 AGGCTAGGAGAACTTGAGTGAGG - Intergenic
1091407196 12:216481-216503 AGGCTAGGAGAACTTGAGTGAGG - Intergenic
1091407212 12:216576-216598 AGGCTAGGAGAACTTGAGTGAGG - Intergenic
1091743310 12:2975271-2975293 AGACTAGGAGAAACTGACTGGGG - Intronic
1091912409 12:4243032-4243054 AGGCTCAGAGAACCTGTGTGTGG - Intergenic
1091992784 12:4970093-4970115 AGGTTAGGAAAACAGGAGTGAGG - Intergenic
1096331267 12:50715164-50715186 AAGCTAGAAGAACATGATTGAGG - Intronic
1096401681 12:51312583-51312605 AGGATAGGAGAAAGTGAGTGGGG + Intronic
1096516103 12:52156443-52156465 AGGCTGAGTGAACTGGAGTGAGG - Intergenic
1096529610 12:52234461-52234483 AGGAAAGGAGAACGTGAGGGAGG - Intronic
1096685582 12:53286327-53286349 AAGCTTGGAGAGCTTGGGTGAGG - Exonic
1096689085 12:53308364-53308386 AGGTTAGGAGAGTTTCAGTGTGG + Intronic
1097724939 12:63064639-63064661 AGGCTAGTAGTTCTTGACTGAGG + Intergenic
1098456634 12:70681581-70681603 AGACAAGGAGACCTTTAGTGAGG - Intronic
1104661376 12:130613381-130613403 AGGGCAAGAGAACCTGAGTGAGG + Intronic
1106181462 13:27373033-27373055 TGTCTAGGAGAGCTTGAGTGTGG - Intergenic
1108565029 13:51688060-51688082 TGTGTAGGAGAAATTGAGTGGGG + Intronic
1111258314 13:85701284-85701306 AGCCTAGGTGAACTTGAGGTCGG - Intergenic
1112167413 13:96934428-96934450 AGAAAAGGAGAACATGAGTGGGG + Intergenic
1112873886 13:104011563-104011585 AGGTTATGAGATGTTGAGTGAGG + Intergenic
1113809095 13:113126785-113126807 AGGCTTGGATAACTTGTCTGAGG + Intronic
1116270095 14:42752797-42752819 AGGCTAGGAAACCTAGTGTGGGG + Intergenic
1122090167 14:99333451-99333473 AGGCCAGAAGAACTTGAGCTCGG + Intergenic
1202883861 14_KI270722v1_random:85814-85836 AGTCTAGGAGAACTGCAGGGCGG - Intergenic
1125043749 15:35222520-35222542 AGGGTAGGACAACTTGAAGGGGG + Intronic
1128915323 15:71554969-71554991 AAGCGAGGAGGACATGAGTGGGG - Intronic
1129183090 15:73889149-73889171 AGGCCAGGGGCACTGGAGTGAGG + Exonic
1129880621 15:79004079-79004101 CGGCGAGGAGAACTTGCGGGTGG + Exonic
1129905044 15:79180666-79180688 AGCCAAGGAGAACTTGAGTTGGG - Intergenic
1135804875 16:25533745-25533767 AGGCTGGGAGATCTGCAGTGAGG + Intergenic
1137492879 16:48947857-48947879 AGGCTAAGTGAAGGTGAGTGTGG + Intergenic
1137668013 16:50262930-50262952 GGGCTGGGAGATCTTGGGTGAGG + Intronic
1139346593 16:66307733-66307755 GGGAGAGGAGAACATGAGTGAGG + Intergenic
1140792409 16:78404712-78404734 AGGCTAGTAGGTCATGAGTGTGG + Intronic
1145842403 17:28006903-28006925 AGGCTAGAAGAACAAGAATGCGG + Intergenic
1146471407 17:33127920-33127942 AGGCTAGAAGGAATTGGGTGGGG - Intronic
1146643883 17:34563534-34563556 AGGCAAGGAGAACATGAGCTAGG - Intergenic
1146715372 17:35082364-35082386 AGGCTAGGAGCCTTTGAGGGTGG - Intronic
1146757752 17:35448475-35448497 AGGCTATGAGGACTTGATCGCGG - Intronic
1148221296 17:45864200-45864222 AGGCTAGGAGATGAGGAGTGGGG + Intergenic
1152217189 17:79040499-79040521 AGACTATGAGACCTTGAGTTGGG + Intronic
1152405670 17:80096601-80096623 GGGGCTGGAGAACTTGAGTGTGG - Intronic
1152530927 17:80918634-80918656 AAGCTAGCAGAACTAGAATGGGG - Intronic
1155258093 18:24015294-24015316 AGGCTGGGAGAAAGTGAGAGGGG - Intronic
1155520899 18:26668043-26668065 AGACTAGGAGAACCTGATAGGGG + Intergenic
1156528141 18:37787679-37787701 AGGCAAGGAGAATCTGGGTGGGG + Intergenic
1157210059 18:45734701-45734723 AGGTTCGGAGAACTGGAGTGCGG - Intronic
1159279394 18:66266311-66266333 AGACTAGGAAAGCTTGAGTTGGG - Intergenic
1159293461 18:66451625-66451647 AGGGAAAGAAAACTTGAGTGTGG - Intergenic
1160196386 18:76758949-76758971 GGGCTAAGAGAACGTGAGTCAGG - Intergenic
1163071202 19:14843537-14843559 AGGCTGGGGGAAGTGGAGTGGGG - Intergenic
1163137148 19:15320333-15320355 AGACTACGAGAACTTGAGTATGG + Intronic
1165651812 19:37497848-37497870 GGGCTAAGAGAAGTTGAATGAGG + Intergenic
1165772919 19:38388918-38388940 CGGCTAGGAGGACTAGAGAGTGG + Intronic
1166653858 19:44595859-44595881 CAGCCAGGAGGACTTGAGTGGGG + Intergenic
928110680 2:28506428-28506450 AGGCTGGCTGAACTGGAGTGTGG + Intronic
928312327 2:30221192-30221214 AGGCTTGGAGATCTTGAGCTTGG - Intergenic
930235857 2:48888494-48888516 AGACTAGGAAAACTTGAGGTGGG + Intergenic
930273065 2:49279073-49279095 AGGCCAGGTGAACTGGAGTTTGG - Intergenic
931094385 2:58922642-58922664 AGGCTTGGAGGACTGGAGTAAGG - Intergenic
932973723 2:76575868-76575890 AGTCAGGGAGAACTAGAGTGGGG + Intergenic
933301082 2:80541777-80541799 AAGCTAGGGAAACCTGAGTGTGG - Intronic
933357819 2:81235858-81235880 AGGGAGGGTGAACTTGAGTGAGG - Intergenic
934159799 2:89237909-89237931 TGGATTGGAAAACTTGAGTGTGG + Intergenic
934207480 2:89944526-89944548 TGGATTGGAAAACTTGAGTGTGG - Intergenic
934658540 2:96130652-96130674 AGGCCTGGGGGACTTGAGTGAGG - Intronic
937672845 2:124557259-124557281 AGGCAAGGAGCAATTGAGAGAGG - Intronic
939115320 2:138053968-138053990 AGGCTGGGAAAATGTGAGTGTGG + Intergenic
944869053 2:203891758-203891780 GGGCCAGGAGATCTTGGGTGAGG + Intergenic
945155656 2:206834688-206834710 AGGCCAGGAGAACATGTATGGGG - Intergenic
946576403 2:221080665-221080687 AGGCCAGGAAAACCTGAGTTTGG + Intergenic
1169084959 20:2820900-2820922 AGGCTAGGAGAGGCCGAGTGGGG + Intergenic
1170540246 20:17380404-17380426 AGGCTCAGAGAAATTTAGTGAGG + Intronic
1176119655 20:63448596-63448618 AGGGAAGGAGATCCTGAGTGTGG - Intronic
1176267184 20:64216113-64216135 GTGCTACGAGAACTTAAGTGTGG - Intronic
1179040915 21:37801602-37801624 AGGCTGGGAGAAGCTGAGTCAGG - Intronic
1179058723 21:37959821-37959843 AGGCTAGGAAGAACTGAGTGAGG + Intronic
1180326750 22:11436513-11436535 AGTCTAGGAGAACTGCAGGGCGG - Intergenic
1181369677 22:22405998-22406020 AGGAGAGGAGAGCTTGTGTGGGG + Intergenic
1181964757 22:26648452-26648474 AGGCCAGGAGACCTTGCCTGAGG - Intergenic
1184634233 22:45813625-45813647 GGGGTGGCAGAACTTGAGTGTGG - Intronic
1203293041 22_KI270736v1_random:13900-13922 AGGCCTGGAGAAGTTCAGTGGGG - Intergenic
949429391 3:3958064-3958086 AAGCTGGGAGAATTTAAGTGGGG - Intronic
949964184 3:9341343-9341365 AGCAAAGGAGCACTTGAGTGTGG - Intronic
950167582 3:10813471-10813493 AGGCTGGGACAATTTGATTGAGG + Intergenic
950275430 3:11656465-11656487 AGGCTAGGAGCACCTGAGCTGGG + Intronic
951085953 3:18512829-18512851 AGGATAGGAGAACTTGGGATAGG + Intergenic
959048882 3:101505196-101505218 AGGCTAGGAGCAGTGCAGTGAGG + Intronic
961941292 3:130639722-130639744 AAGCTCTGAGAACATGAGTGGGG + Intronic
963525839 3:146412528-146412550 AGCCAAGGAGTACTTCAGTGAGG + Intronic
963649405 3:147958945-147958967 AGGATAGGAGAACATGAGAAAGG + Intergenic
964968561 3:162530234-162530256 TGTCTGGGAGAACGTGAGTGTGG - Intergenic
971773508 4:30930151-30930173 AGTAGAGGAGGACTTGAGTGTGG + Intronic
972090389 4:35273920-35273942 CGGAAAGGAGAACTGGAGTGAGG - Intergenic
973172481 4:47162934-47162956 AAGCTATGAGAACTAGTGTGAGG - Intronic
974310138 4:60195649-60195671 TGGCTAGGAGAAATTCAATGAGG - Intergenic
975032165 4:69634399-69634421 AGGGTATGAGAATTAGAGTGGGG + Intronic
975828768 4:78347345-78347367 GGACTAGGAGAGCTTTAGTGAGG - Intronic
981039845 4:140213007-140213029 AGGGCAGGACAACTTGAGTGGGG - Intergenic
981127483 4:141123243-141123265 AGGCTTGGGGAACTTAACTGTGG + Intronic
982215791 4:153081698-153081720 AGGTCAGGAGAACCAGAGTGTGG - Intergenic
983510021 4:168599060-168599082 AGGCTTGGAGAAGTTGAGTTGGG - Intronic
986635345 5:9816677-9816699 AGGCTAAGAGAACTTGATGATGG - Intergenic
990235119 5:53759268-53759290 AGGCGAGGATATCTTGAGTCAGG - Intergenic
991633565 5:68680772-68680794 AGGCTGGGAGGAGTGGAGTGGGG + Intergenic
992317056 5:75566662-75566684 AGGCTAGGAGAAGCAGGGTGGGG - Intronic
994938726 5:106291169-106291191 AGGCCAGGAGAAATTAAGAGAGG + Intergenic
996927248 5:128842262-128842284 AGACTAGGAGAACTTGAGAGTGG + Intronic
998252214 5:140560958-140560980 AGGCAAGGGGAAGGTGAGTGAGG - Intronic
1001351651 5:170973767-170973789 AGGCTAGCAGATTTTGTGTGTGG + Intronic
1004847466 6:19661246-19661268 AGGCGAGGAGAAACTGAATGAGG - Intergenic
1005580019 6:27224902-27224924 AAGCTCAGAGCACTTGAGTGTGG + Intergenic
1006501423 6:34461547-34461569 AGCCTAGGAGAACAGGAGGGTGG - Intergenic
1007481521 6:42153529-42153551 AGGTGGGGAGAACTTGTGTGGGG - Intergenic
1008683255 6:53896848-53896870 AGACTAGAAGAACTTGATTTAGG + Exonic
1009764429 6:68051893-68051915 AATCTAGGAGAACTTGAGTTTGG - Intergenic
1012088400 6:94859382-94859404 ACGCTAGGAGAAATTGGGTAGGG - Intergenic
1013259690 6:108429353-108429375 AGGCAAGAAGAACTTGTGTAGGG + Intronic
1014288499 6:119530737-119530759 AGAGTAGGAAAACTTGAGGGGGG + Intergenic
1015231764 6:130923041-130923063 AGGGTAGGAGGACTCGACTGGGG - Intronic
1020339717 7:7096614-7096636 AGACTTGGAAAACTAGAGTGAGG + Intergenic
1021160194 7:17263287-17263309 AGGCTATGAGGACTTGGCTGTGG - Intergenic
1023064566 7:36364629-36364651 TGGTTAGCAGAACTTGATTGTGG - Intronic
1023913817 7:44573742-44573764 AGCCTAGGAGACCAGGAGTGCGG + Exonic
1030583844 7:111392459-111392481 AGGCCAGGAAAACTGGAGGGAGG - Intronic
1033495719 7:141892975-141892997 AATCTAGGTGACCTTGAGTGTGG + Intergenic
1035061760 7:156074614-156074636 AGCCCAGGAGGACTTGAATGCGG + Intergenic
1038615580 8:29090831-29090853 AGGCTATGAGAATTAGAATGAGG - Intronic
1038783400 8:30588559-30588581 AGGCTAGGAGAAGGGGAATGAGG + Intronic
1044396947 8:91723820-91723842 AGGCTTGGAGGAATTCAGTGAGG - Intergenic
1045016393 8:98004901-98004923 AGGATAGGAGCGCCTGAGTGTGG + Intronic
1048975708 8:139672029-139672051 AGGCTAGGAGAACAAGGGCGGGG + Intronic
1049696561 8:143986776-143986798 AGGCTTGGAGATCCTGAGTGAGG - Intronic
1050978066 9:11967250-11967272 TGCCAAGGAGAACTGGAGTGTGG - Intergenic
1051512696 9:17896855-17896877 AGGAAAGGAGAAATTGAGAGAGG - Intergenic
1052046867 9:23803895-23803917 AGACTTGGAGAACTTGAGAGTGG + Intronic
1053102259 9:35380892-35380914 TGGGTAGGAGAACAGGAGTGTGG - Intronic
1055618739 9:78100852-78100874 ATGTTAGGAGAAATTGGGTGTGG + Intergenic
1056891588 9:90499149-90499171 AGGCTAGAAGAGCTGGAGTGAGG - Intergenic
1057390558 9:94638942-94638964 AGGAGATGAGGACTTGAGTGAGG + Intronic
1060480494 9:124014288-124014310 TGGCTTGGAGAACTTGGGGGGGG - Intronic
1061948436 9:133921758-133921780 AGGCTAGGGGTCCTTGTGTGTGG - Intronic
1062340360 9:136091333-136091355 AGGCTGTGTGACCTTGAGTGAGG - Intronic
1185567598 X:1107704-1107726 ATCCTAGGAGCACTTTAGTGAGG + Intergenic
1186003473 X:5041280-5041302 AGGCTATAAGAACTTCAGTGGGG - Intergenic
1186696032 X:12033163-12033185 AGGCTAAGTGAATTTGAGAGGGG + Intergenic
1187440348 X:19312463-19312485 AGGCAAAGAGAACTTGTGTAGGG + Intergenic
1189344707 X:40232271-40232293 AGGGCAGGAGAACTTGGCTGGGG + Intergenic
1190501863 X:51087135-51087157 TTGTTAAGAGAACTTGAGTGTGG - Intergenic
1192550159 X:72047235-72047257 AGGTAAGGAGAGCATGAGTGTGG - Intergenic
1192575477 X:72239810-72239832 AGGCTAGGATAACAGGCGTGAGG - Intronic
1193231764 X:79055714-79055736 TGGCTAGAACAACTTGAGAGAGG - Intergenic
1194350159 X:92817154-92817176 AGGCTAGGGGAAAGTGAGAGTGG + Intergenic
1197336900 X:125219985-125220007 AGGCTAGGGGAACTTATCTGTGG - Intergenic
1198108156 X:133480325-133480347 AGCCTAGGAGATCTGGAGTGGGG + Intergenic
1199280886 X:145997896-145997918 TGGCCAGGAGAACTGGATTGGGG - Intergenic
1199283088 X:146024830-146024852 TGGCCAGGAGAACTGGATTGGGG - Intergenic
1199890899 X:152080721-152080743 AGACTAGGAGAACATGGGTTTGG + Intergenic
1200150332 X:153948230-153948252 AGCCTAGGGGAGCTTGAGGGAGG - Exonic
1200473958 Y:3622703-3622725 AGCCTTGGAGAACCTGTGTGTGG - Intergenic
1200888793 Y:8299490-8299512 AGCCTTGGAGAACCTGTGTGTGG + Intergenic