ID: 1091407196

View in Genome Browser
Species Human (GRCh38)
Location 12:216481-216503
Sequence AGGCTAGGAGAACTTGAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 6, 1: 1, 2: 1, 3: 15, 4: 169}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091407196_1091407198 -8 Left 1091407196 12:216481-216503 CCTCACTCAAGTTCTCCTAGCCT 0: 6
1: 1
2: 1
3: 15
4: 169
Right 1091407198 12:216496-216518 CCTAGCCTCCAAGACCCACTTGG 0: 7
1: 0
2: 1
3: 11
4: 164
1091407196_1091407201 4 Left 1091407196 12:216481-216503 CCTCACTCAAGTTCTCCTAGCCT 0: 6
1: 1
2: 1
3: 15
4: 169
Right 1091407201 12:216508-216530 GACCCACTTGGTGTTCAGACTGG 0: 2
1: 2
2: 1
3: 5
4: 56
1091407196_1091407204 19 Left 1091407196 12:216481-216503 CCTCACTCAAGTTCTCCTAGCCT 0: 6
1: 1
2: 1
3: 15
4: 169
Right 1091407204 12:216523-216545 CAGACTGGTTAGTAAACCCCTGG 0: 1
1: 3
2: 2
3: 6
4: 91
1091407196_1091407205 22 Left 1091407196 12:216481-216503 CCTCACTCAAGTTCTCCTAGCCT 0: 6
1: 1
2: 1
3: 15
4: 169
Right 1091407205 12:216526-216548 ACTGGTTAGTAAACCCCTGGAGG 0: 1
1: 2
2: 1
3: 5
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091407196 Original CRISPR AGGCTAGGAGAACTTGAGTG AGG (reversed) Intergenic