ID: 1091407198

View in Genome Browser
Species Human (GRCh38)
Location 12:216496-216518
Sequence CCTAGCCTCCAAGACCCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 7, 1: 0, 2: 1, 3: 11, 4: 164}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091407195_1091407198 -4 Left 1091407195 12:216477-216499 CCTTCCTCACTCAAGTTCTCCTA 0: 6
1: 1
2: 2
3: 21
4: 284
Right 1091407198 12:216496-216518 CCTAGCCTCCAAGACCCACTTGG 0: 7
1: 0
2: 1
3: 11
4: 164
1091407193_1091407198 19 Left 1091407193 12:216454-216476 CCAGAGACTCTCTAATGTTGAGC 0: 6
1: 0
2: 0
3: 3
4: 82
Right 1091407198 12:216496-216518 CCTAGCCTCCAAGACCCACTTGG 0: 7
1: 0
2: 1
3: 11
4: 164
1091407194_1091407198 -3 Left 1091407194 12:216476-216498 CCCTTCCTCACTCAAGTTCTCCT 0: 6
1: 1
2: 1
3: 33
4: 398
Right 1091407198 12:216496-216518 CCTAGCCTCCAAGACCCACTTGG 0: 7
1: 0
2: 1
3: 11
4: 164
1091407196_1091407198 -8 Left 1091407196 12:216481-216503 CCTCACTCAAGTTCTCCTAGCCT 0: 6
1: 1
2: 1
3: 15
4: 169
Right 1091407198 12:216496-216518 CCTAGCCTCCAAGACCCACTTGG 0: 7
1: 0
2: 1
3: 11
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091407198 Original CRISPR CCTAGCCTCCAAGACCCACT TGG Intergenic