ID: 1091407201

View in Genome Browser
Species Human (GRCh38)
Location 12:216508-216530
Sequence GACCCACTTGGTGTTCAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 2, 1: 2, 2: 1, 3: 5, 4: 56}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091407196_1091407201 4 Left 1091407196 12:216481-216503 CCTCACTCAAGTTCTCCTAGCCT 0: 6
1: 1
2: 1
3: 15
4: 169
Right 1091407201 12:216508-216530 GACCCACTTGGTGTTCAGACTGG 0: 2
1: 2
2: 1
3: 5
4: 56
1091407194_1091407201 9 Left 1091407194 12:216476-216498 CCCTTCCTCACTCAAGTTCTCCT 0: 6
1: 1
2: 1
3: 33
4: 398
Right 1091407201 12:216508-216530 GACCCACTTGGTGTTCAGACTGG 0: 2
1: 2
2: 1
3: 5
4: 56
1091407195_1091407201 8 Left 1091407195 12:216477-216499 CCTTCCTCACTCAAGTTCTCCTA 0: 6
1: 1
2: 2
3: 21
4: 284
Right 1091407201 12:216508-216530 GACCCACTTGGTGTTCAGACTGG 0: 2
1: 2
2: 1
3: 5
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091407201 Original CRISPR GACCCACTTGGTGTTCAGAC TGG Intergenic