ID: 1091407201

View in Genome Browser
Species Human (GRCh38)
Location 12:216508-216530
Sequence GACCCACTTGGTGTTCAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 2, 1: 2, 2: 1, 3: 5, 4: 56}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091407196_1091407201 4 Left 1091407196 12:216481-216503 CCTCACTCAAGTTCTCCTAGCCT 0: 6
1: 1
2: 1
3: 15
4: 169
Right 1091407201 12:216508-216530 GACCCACTTGGTGTTCAGACTGG 0: 2
1: 2
2: 1
3: 5
4: 56
1091407194_1091407201 9 Left 1091407194 12:216476-216498 CCCTTCCTCACTCAAGTTCTCCT 0: 6
1: 1
2: 1
3: 33
4: 398
Right 1091407201 12:216508-216530 GACCCACTTGGTGTTCAGACTGG 0: 2
1: 2
2: 1
3: 5
4: 56
1091407195_1091407201 8 Left 1091407195 12:216477-216499 CCTTCCTCACTCAAGTTCTCCTA 0: 6
1: 1
2: 2
3: 21
4: 284
Right 1091407201 12:216508-216530 GACCCACTTGGTGTTCAGACTGG 0: 2
1: 2
2: 1
3: 5
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091407201 Original CRISPR GACCCACTTGGTGTTCAGAC TGG Intergenic
901441957 1:9283387-9283409 CACCAACTTGCTTTTCAGACAGG - Intergenic
902650227 1:17832593-17832615 GCCCCACCTGGTGTTCAGCAAGG - Intergenic
923698162 1:236275280-236275302 GAGCCACTTGTTCTTCTGACTGG + Intronic
1069236136 10:66076587-66076609 AACCCACTGGGTGTTAAGAGGGG - Intronic
1074898369 10:117796094-117796116 GACCCACTTGGAGGGAAGACAGG - Intergenic
1077014932 11:395318-395340 GGTCCACTTGGTGTTTAGAGGGG + Intronic
1078783600 11:14464134-14464156 GATACACTTGGAGTTCAGAATGG - Intronic
1078869458 11:15329954-15329976 GACCCACTAGGTTGCCAGACTGG - Intergenic
1091407158 12:216223-216245 GACCCACTTGGTATTCAGACTGG + Intergenic
1091407171 12:216318-216340 GACCCACTTGGTGTTCAGACCGG + Intergenic
1091407201 12:216508-216530 GACCCACTTGGTGTTCAGACTGG + Intergenic
1091407217 12:216603-216625 GACCCACTTGGTATTCAGACTGG + Intergenic
1093680379 12:21995666-21995688 GATCCTCTTGGTGCTCCGACAGG + Intergenic
1104632019 12:130411323-130411345 GTCACACCTGGTGTACAGACTGG - Intronic
1117992159 14:61444695-61444717 CACCCAGTTGGTGATGAGACTGG - Intronic
1122551456 14:102552319-102552341 GTCCCACTTGCTGTTCTGCCAGG + Intergenic
1127220136 15:56870966-56870988 GTCTCACTTGGTGCCCAGACTGG - Intronic
1133772801 16:8877356-8877378 GATCCACTTGCTGTTCTGACAGG - Intergenic
1134463388 16:14449790-14449812 CACCCACTAGGTTTTTAGACTGG + Intronic
1148214831 17:45828843-45828865 GGTCCACCTGGTGTTCTGACTGG + Intronic
1154337667 18:13478384-13478406 AACCCAGTTGATGTTCAGAATGG - Intronic
1156188367 18:34689910-34689932 AAGCCACTGGGAGTTCAGACTGG - Intronic
1157999283 18:52597357-52597379 GCCCAACTTGGTATTCAGAGTGG + Intronic
1160978372 19:1805431-1805453 GACCAACTTGAAGTTCAGACAGG - Exonic
1164117247 19:22234458-22234480 GACCCACTTTGTGGTTAGATGGG + Intergenic
1168078884 19:53994806-53994828 TACCCACTTGGTGTCCAGATGGG + Intronic
926698787 2:15788750-15788772 GGACCACTTGGTGTGGAGACGGG + Intergenic
930155849 2:48107001-48107023 GACCTACTTGTTTTTCAGATGGG + Intergenic
938873940 2:135512966-135512988 GACCCATTTGGTGCAAAGACAGG + Intronic
940057563 2:149528956-149528978 AACCCACTAGGGGCTCAGACAGG - Intergenic
940810757 2:158240159-158240181 GCCCAAGTTGGTGTTCAGAGTGG + Intronic
946846331 2:223861991-223862013 GACCAACTTTGTATCCAGACAGG + Intronic
1182777540 22:32841988-32842010 GACCTTCTTGGTGCTCAGTCCGG - Intronic
950579367 3:13852506-13852528 GACCCACTCCTTGTTCCGACCGG - Intronic
956200680 3:66702406-66702428 GACCTCCTTGGTTTTCAAACAGG + Intergenic
962402225 3:135070290-135070312 GACCCACCTGGAGTGAAGACTGG - Intronic
966339405 3:178908570-178908592 GACCTACTGCGTGTGCAGACCGG - Intergenic
969302015 4:6302656-6302678 AACACACTTGGTATTCAGAGTGG - Exonic
970536642 4:17036696-17036718 GACCCACTATGTGCTCAGGCTGG + Intergenic
975822197 4:78282952-78282974 GACCCACCTGATGTGCAGTCTGG - Exonic
982803528 4:159734240-159734262 TACCTACTTGGTGTTCAGTTTGG + Intergenic
983045068 4:162976513-162976535 GGCCCTTTTGATGTTCAGACAGG + Intergenic
987340319 5:16934265-16934287 GACCCCTGTGGTGCTCAGACAGG + Intronic
987485791 5:18524299-18524321 GTCCCACTTGTTGCTCAGGCTGG + Intergenic
995781214 5:115777282-115777304 GAGGAACTTGGTGTTCAGAGGGG - Intergenic
1000939313 5:167341004-167341026 GACCCTCTTGGTTTGCAGAATGG + Intronic
1001345758 5:170896931-170896953 GACCCAGTTGGTGGTCATACTGG + Intronic
1002700673 5:181122360-181122382 GACACTCTAGGTGTTCAGAGAGG - Intergenic
1006990458 6:38210927-38210949 GACCCACTTGGTGTTCAGGAGGG - Intronic
1011417629 6:87139189-87139211 GAACCACTTGGAGTTGATACTGG + Intergenic
1016878330 6:148885622-148885644 AGCCCACTTGGTGTTCACAGTGG - Intronic
1017944221 6:159080524-159080546 GTCCCACTTTGTGCACAGACTGG + Intergenic
1018916375 6:168134990-168135012 CAGCCACTTGGTGGTCAGGCAGG + Intergenic
1020134746 7:5580936-5580958 GGCCCACGTGGTTTTCAGTCTGG + Intergenic
1022032254 7:26503215-26503237 GACCCAGGTGATCTTCAGACTGG + Intergenic
1024013109 7:45287528-45287550 CACCCAGTTGGTGTCCAGAGAGG - Intergenic
1032408535 7:131675428-131675450 GACTCACTGGATGGTCAGACAGG - Intergenic
1041925775 8:63234721-63234743 GACCCACTTGGTTTCCAAACTGG + Intergenic
1049282099 8:141754798-141754820 GACCAACTTGTTTTTCAGAATGG + Intergenic
1051864811 9:21667765-21667787 GAACTACTTGGTGTTCAGTTTGG - Intergenic
1052009667 9:23391116-23391138 GATCCACTTGATATTCACACAGG - Intergenic
1062027095 9:134345573-134345595 CACCCACTAGGTGTTCATCCAGG + Intronic
1187976988 X:24712759-24712781 GATCCATTTGGTGTTTATACTGG + Intronic
1193957298 X:87878325-87878347 GACCCACTTTGTGGTTAGATGGG - Intergenic
1199366008 X:146984052-146984074 TACCCATTTGCTATTCAGACTGG + Intergenic
1202057257 Y:20848110-20848132 GACCCACTGTGTATCCAGACTGG - Intergenic