ID: 1091407204

View in Genome Browser
Species Human (GRCh38)
Location 12:216523-216545
Sequence CAGACTGGTTAGTAAACCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 3, 2: 2, 3: 6, 4: 91}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091407197_1091407204 4 Left 1091407197 12:216496-216518 CCTAGCCTCCAAGACCCACTTGG 0: 7
1: 0
2: 0
3: 14
4: 248
Right 1091407204 12:216523-216545 CAGACTGGTTAGTAAACCCCTGG 0: 1
1: 3
2: 2
3: 6
4: 91
1091407199_1091407204 -1 Left 1091407199 12:216501-216523 CCTCCAAGACCCACTTGGTGTTC 0: 2
1: 5
2: 2
3: 13
4: 185
Right 1091407204 12:216523-216545 CAGACTGGTTAGTAAACCCCTGG 0: 1
1: 3
2: 2
3: 6
4: 91
1091407202_1091407204 -10 Left 1091407202 12:216510-216532 CCCACTTGGTGTTCAGACTGGTT 0: 1
1: 3
2: 3
3: 15
4: 111
Right 1091407204 12:216523-216545 CAGACTGGTTAGTAAACCCCTGG 0: 1
1: 3
2: 2
3: 6
4: 91
1091407200_1091407204 -4 Left 1091407200 12:216504-216526 CCAAGACCCACTTGGTGTTCAGA 0: 2
1: 5
2: 0
3: 14
4: 130
Right 1091407204 12:216523-216545 CAGACTGGTTAGTAAACCCCTGG 0: 1
1: 3
2: 2
3: 6
4: 91
1091407194_1091407204 24 Left 1091407194 12:216476-216498 CCCTTCCTCACTCAAGTTCTCCT 0: 6
1: 1
2: 1
3: 33
4: 398
Right 1091407204 12:216523-216545 CAGACTGGTTAGTAAACCCCTGG 0: 1
1: 3
2: 2
3: 6
4: 91
1091407196_1091407204 19 Left 1091407196 12:216481-216503 CCTCACTCAAGTTCTCCTAGCCT 0: 6
1: 1
2: 1
3: 15
4: 169
Right 1091407204 12:216523-216545 CAGACTGGTTAGTAAACCCCTGG 0: 1
1: 3
2: 2
3: 6
4: 91
1091407195_1091407204 23 Left 1091407195 12:216477-216499 CCTTCCTCACTCAAGTTCTCCTA 0: 6
1: 1
2: 2
3: 21
4: 284
Right 1091407204 12:216523-216545 CAGACTGGTTAGTAAACCCCTGG 0: 1
1: 3
2: 2
3: 6
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091407204 Original CRISPR CAGACTGGTTAGTAAACCCC TGG Intergenic