ID: 1091407217

View in Genome Browser
Species Human (GRCh38)
Location 12:216603-216625
Sequence GACCCACTTGGTATTCAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 2, 1: 2, 2: 0, 3: 8, 4: 61}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091407211_1091407217 8 Left 1091407211 12:216572-216594 CCTTCCTCACTCAAGTTCTCCTA 0: 6
1: 1
2: 2
3: 21
4: 284
Right 1091407217 12:216603-216625 GACCCACTTGGTATTCAGACTGG 0: 2
1: 2
2: 0
3: 8
4: 61
1091407210_1091407217 9 Left 1091407210 12:216571-216593 CCCTTCCTCACTCAAGTTCTCCT 0: 6
1: 1
2: 1
3: 33
4: 398
Right 1091407217 12:216603-216625 GACCCACTTGGTATTCAGACTGG 0: 2
1: 2
2: 0
3: 8
4: 61
1091407212_1091407217 4 Left 1091407212 12:216576-216598 CCTCACTCAAGTTCTCCTAGCCT 0: 6
1: 1
2: 1
3: 15
4: 169
Right 1091407217 12:216603-216625 GACCCACTTGGTATTCAGACTGG 0: 2
1: 2
2: 0
3: 8
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091407217 Original CRISPR GACCCACTTGGTATTCAGAC TGG Intergenic