ID: 1091407217

View in Genome Browser
Species Human (GRCh38)
Location 12:216603-216625
Sequence GACCCACTTGGTATTCAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 2, 1: 2, 2: 0, 3: 8, 4: 61}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091407210_1091407217 9 Left 1091407210 12:216571-216593 CCCTTCCTCACTCAAGTTCTCCT 0: 6
1: 1
2: 1
3: 33
4: 398
Right 1091407217 12:216603-216625 GACCCACTTGGTATTCAGACTGG 0: 2
1: 2
2: 0
3: 8
4: 61
1091407211_1091407217 8 Left 1091407211 12:216572-216594 CCTTCCTCACTCAAGTTCTCCTA 0: 6
1: 1
2: 2
3: 21
4: 284
Right 1091407217 12:216603-216625 GACCCACTTGGTATTCAGACTGG 0: 2
1: 2
2: 0
3: 8
4: 61
1091407212_1091407217 4 Left 1091407212 12:216576-216598 CCTCACTCAAGTTCTCCTAGCCT 0: 6
1: 1
2: 1
3: 15
4: 169
Right 1091407217 12:216603-216625 GACCCACTTGGTATTCAGACTGG 0: 2
1: 2
2: 0
3: 8
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091407217 Original CRISPR GACCCACTTGGTATTCAGAC TGG Intergenic
900878366 1:5362590-5362612 GAGCCACTTGCTATTGTGACTGG + Intergenic
901441957 1:9283387-9283409 CACCAACTTGCTTTTCAGACAGG - Intergenic
902246241 1:15122662-15122684 GAGCCCCCTGATATTCAGACAGG + Intergenic
902720196 1:18298905-18298927 GACCTACTTGGCATTTAGAAAGG + Intronic
909390639 1:75117095-75117117 GACCCATTTGTTATTCAACCAGG + Intergenic
911658956 1:100478147-100478169 GACACATTTGGGATTCAGAATGG - Intronic
923698162 1:236275280-236275302 GAGCCACTTGTTCTTCTGACTGG + Intronic
923974052 1:239239846-239239868 GACACACATGGTATCCAGTCTGG - Intergenic
924043774 1:240008670-240008692 GGCCCACGTGGGATGCAGACAGG - Intergenic
1068024830 10:51629743-51629765 GACCCACTTGTTAATAAGCCAGG - Intronic
1068377001 10:56193812-56193834 CACTGACTTGGAATTCAGACAGG - Intergenic
1069438229 10:68405851-68405873 TATTAACTTGGTATTCAGACTGG - Intronic
1071224402 10:83511243-83511265 GACCAATTTGGTATTCATAGGGG + Intergenic
1078869458 11:15329954-15329976 GACCCACTAGGTTGCCAGACTGG - Intergenic
1079296477 11:19239626-19239648 GAACAACTTGGAATTCAGAAAGG - Intronic
1079333594 11:19552540-19552562 GACCCAAATGGGATTCAGGCTGG - Intronic
1079585724 11:22124891-22124913 AAACCACTTGGTAGTCATACAGG - Intergenic
1086535761 11:87843183-87843205 GACCAGCATGGTATTCAGAGAGG - Intergenic
1088359731 11:108977826-108977848 GAGCCACTGGCTATTCACACGGG - Intergenic
1091407158 12:216223-216245 GACCCACTTGGTATTCAGACTGG + Intergenic
1091407171 12:216318-216340 GACCCACTTGGTGTTCAGACCGG + Intergenic
1091407201 12:216508-216530 GACCCACTTGGTGTTCAGACTGG + Intergenic
1091407217 12:216603-216625 GACCCACTTGGTATTCAGACTGG + Intergenic
1091833450 12:3567423-3567445 CACCCATTTGGTATTGAGCCTGG + Intronic
1094714144 12:32994902-32994924 GACCCACTTGGGAATCAGCTGGG + Intergenic
1094754731 12:33454786-33454808 GGCCCTCTTGGTATACAGAACGG - Intergenic
1097754592 12:63395601-63395623 GATGCTCTTGGAATTCAGACTGG - Intergenic
1107545024 13:41427174-41427196 TACCCACTTGGTATTAGGATCGG - Intergenic
1108420762 13:50246729-50246751 GTCCCACTTGGCATTCATGCTGG + Intronic
1129592944 15:76933207-76933229 GACCCACTTGGAACGCTGACAGG - Intronic
1129641517 15:77383517-77383539 TTCCCACTAGGGATTCAGACTGG + Intronic
1130447812 15:84020252-84020274 GACACACTTGGGATCCAGTCCGG + Intronic
1133772801 16:8877356-8877378 GATCCACTTGCTGTTCTGACAGG - Intergenic
1134463388 16:14449790-14449812 CACCCACTAGGTTTTTAGACTGG + Intronic
1138923090 16:61556349-61556371 GACCCACGTGGAAAACAGACTGG - Intergenic
1144302041 17:13930411-13930433 GACCAACTTGGTATCCAAAAAGG + Intergenic
1157999283 18:52597357-52597379 GCCCAACTTGGTATTCAGAGTGG + Intronic
1158200622 18:54935537-54935559 GGCCCACTTGGTATTTACAAGGG - Intronic
1160156257 18:76436131-76436153 GCCCCCCTTAGTATCCAGACAGG - Intronic
1160978372 19:1805431-1805453 GACCAACTTGAAGTTCAGACAGG - Exonic
1164683339 19:30150459-30150481 GACAAACCTGGTATTCAGAGAGG - Intergenic
1168078884 19:53994806-53994828 TACCCACTTGGTGTCCAGATGGG + Intronic
927958741 2:27226152-27226174 GACCCACTGGGCATCCACACTGG + Exonic
930155849 2:48107001-48107023 GACCTACTTGTTTTTCAGATGGG + Intergenic
931442583 2:62301190-62301212 GACCCACAGGGGACTCAGACTGG - Intergenic
935332183 2:101985394-101985416 GTCCCACCTGGTACTCAGAGGGG - Intergenic
946846331 2:223861991-223862013 GACCAACTTTGTATCCAGACAGG + Intronic
955260717 3:57387648-57387670 GACTCCCTTGGAATTCAGAATGG + Intronic
956200680 3:66702406-66702428 GACCTCCTTGGTTTTCAAACAGG + Intergenic
961473578 3:127133703-127133725 GACCCACTTTGTAATCACATTGG + Intergenic
969302015 4:6302656-6302678 AACACACTTGGTATTCAGAGTGG - Exonic
975511424 4:75197646-75197668 AACACACTTGGTACACAGACCGG - Intergenic
1000939313 5:167341004-167341026 GACCCTCTTGGTTTGCAGAATGG + Intronic
1001345758 5:170896931-170896953 GACCCAGTTGGTGGTCATACTGG + Intronic
1006012500 6:31054466-31054488 GAGCCTCTTGGGACTCAGACAGG + Intergenic
1006990458 6:38210927-38210949 GACCCACTTGGTGTTCAGGAGGG - Intronic
1014199929 6:118597815-118597837 GCCCCACACGGTATCCAGACTGG - Intronic
1019281704 7:203601-203623 GACCCACTTGGTAGACTGAGTGG + Intronic
1020134746 7:5580936-5580958 GGCCCACGTGGTTTTCAGTCTGG + Intergenic
1020214267 7:6177667-6177689 GGCTCGCTTGGTATTGAGACGGG + Intronic
1022032254 7:26503215-26503237 GACCCAGGTGATCTTCAGACTGG + Intergenic
1028341150 7:89721018-89721040 GACCCAGATGGCATTCAGTCAGG - Intergenic
1030611303 7:111692426-111692448 GAGCCACATGGAATCCAGACTGG + Intergenic
1037513185 8:19604187-19604209 GACCCCCTTGGTAATCAGGGTGG + Intronic
1038866240 8:31441421-31441443 GACACAGGTGGTATTCAGAGTGG - Intergenic
1039275989 8:35934527-35934549 GTCCCACTGGGTATCCATACTGG - Intergenic
1041925775 8:63234721-63234743 GACCCACTTGGTTTCCAAACTGG + Intergenic
1045714554 8:105026302-105026324 GACACACTAGGTATTTAGATGGG + Intronic
1049282099 8:141754798-141754820 GACCAACTTGTTTTTCAGAATGG + Intergenic
1052009667 9:23391116-23391138 GATCCACTTGATATTCACACAGG - Intergenic
1187053328 X:15715653-15715675 GTCTCACTTTGTACTCAGACTGG + Intronic
1199366008 X:146984052-146984074 TACCCATTTGCTATTCAGACTGG + Intergenic
1202057257 Y:20848110-20848132 GACCCACTGTGTATCCAGACTGG - Intergenic