ID: 1091407885

View in Genome Browser
Species Human (GRCh38)
Location 12:220470-220492
Sequence CTCAGCACGGTGATGGGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 288}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091407885_1091407907 22 Left 1091407885 12:220470-220492 CCCGCCCCCATCACCGTGCTGAG 0: 1
1: 0
2: 1
3: 26
4: 288
Right 1091407907 12:220515-220537 GGGGGAGGCTAGGATGGGGAGGG 0: 1
1: 0
2: 6
3: 118
4: 1192
1091407885_1091407910 28 Left 1091407885 12:220470-220492 CCCGCCCCCATCACCGTGCTGAG 0: 1
1: 0
2: 1
3: 26
4: 288
Right 1091407910 12:220521-220543 GGCTAGGATGGGGAGGGGCAGGG 0: 1
1: 0
2: 9
3: 89
4: 1082
1091407885_1091407906 21 Left 1091407885 12:220470-220492 CCCGCCCCCATCACCGTGCTGAG 0: 1
1: 0
2: 1
3: 26
4: 288
Right 1091407906 12:220514-220536 TGGGGGAGGCTAGGATGGGGAGG 0: 1
1: 0
2: 8
3: 76
4: 874
1091407885_1091407896 3 Left 1091407885 12:220470-220492 CCCGCCCCCATCACCGTGCTGAG 0: 1
1: 0
2: 1
3: 26
4: 288
Right 1091407896 12:220496-220518 GCCCCAGTGAGAACTCAATGGGG 0: 1
1: 1
2: 14
3: 188
4: 1146
1091407885_1091407908 23 Left 1091407885 12:220470-220492 CCCGCCCCCATCACCGTGCTGAG 0: 1
1: 0
2: 1
3: 26
4: 288
Right 1091407908 12:220516-220538 GGGGAGGCTAGGATGGGGAGGGG 0: 1
1: 1
2: 10
3: 166
4: 1439
1091407885_1091407904 17 Left 1091407885 12:220470-220492 CCCGCCCCCATCACCGTGCTGAG 0: 1
1: 0
2: 1
3: 26
4: 288
Right 1091407904 12:220510-220532 TCAATGGGGGAGGCTAGGATGGG 0: 1
1: 0
2: 0
3: 12
4: 162
1091407885_1091407901 7 Left 1091407885 12:220470-220492 CCCGCCCCCATCACCGTGCTGAG 0: 1
1: 0
2: 1
3: 26
4: 288
Right 1091407901 12:220500-220522 CAGTGAGAACTCAATGGGGGAGG 0: 1
1: 0
2: 0
3: 12
4: 193
1091407885_1091407902 12 Left 1091407885 12:220470-220492 CCCGCCCCCATCACCGTGCTGAG 0: 1
1: 0
2: 1
3: 26
4: 288
Right 1091407902 12:220505-220527 AGAACTCAATGGGGGAGGCTAGG 0: 1
1: 0
2: 3
3: 16
4: 206
1091407885_1091407898 4 Left 1091407885 12:220470-220492 CCCGCCCCCATCACCGTGCTGAG 0: 1
1: 0
2: 1
3: 26
4: 288
Right 1091407898 12:220497-220519 CCCCAGTGAGAACTCAATGGGGG 0: 1
1: 0
2: 1
3: 42
4: 380
1091407885_1091407905 18 Left 1091407885 12:220470-220492 CCCGCCCCCATCACCGTGCTGAG 0: 1
1: 0
2: 1
3: 26
4: 288
Right 1091407905 12:220511-220533 CAATGGGGGAGGCTAGGATGGGG 0: 1
1: 0
2: 2
3: 25
4: 276
1091407885_1091407909 27 Left 1091407885 12:220470-220492 CCCGCCCCCATCACCGTGCTGAG 0: 1
1: 0
2: 1
3: 26
4: 288
Right 1091407909 12:220520-220542 AGGCTAGGATGGGGAGGGGCAGG 0: 1
1: 1
2: 4
3: 114
4: 1151
1091407885_1091407903 16 Left 1091407885 12:220470-220492 CCCGCCCCCATCACCGTGCTGAG 0: 1
1: 0
2: 1
3: 26
4: 288
Right 1091407903 12:220509-220531 CTCAATGGGGGAGGCTAGGATGG 0: 1
1: 0
2: 1
3: 11
4: 170
1091407885_1091407894 1 Left 1091407885 12:220470-220492 CCCGCCCCCATCACCGTGCTGAG 0: 1
1: 0
2: 1
3: 26
4: 288
Right 1091407894 12:220494-220516 GGGCCCCAGTGAGAACTCAATGG 0: 1
1: 0
2: 0
3: 13
4: 166
1091407885_1091407895 2 Left 1091407885 12:220470-220492 CCCGCCCCCATCACCGTGCTGAG 0: 1
1: 0
2: 1
3: 26
4: 288
Right 1091407895 12:220495-220517 GGCCCCAGTGAGAACTCAATGGG 0: 1
1: 0
2: 0
3: 6
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091407885 Original CRISPR CTCAGCACGGTGATGGGGGC GGG (reversed) Intergenic
900118420 1:1038444-1038466 CTCACCAGGGTGAGCGGGGCTGG - Intronic
900254761 1:1692405-1692427 CTCTGCTCGGTGATCGGTGCTGG - Intronic
900461070 1:2802325-2802347 CTCAACCCTGTGATGGGGGAGGG - Intergenic
900977201 1:6025312-6025334 CTCAACACGGTGCAGGTGGCTGG + Intronic
901489504 1:9589343-9589365 CCCAGCACGGGGCTGAGGGCAGG - Intronic
901541790 1:9922573-9922595 CTGAGCACTGTGCTAGGGGCAGG - Intronic
902148667 1:14424840-14424862 CTCAGCAAGCAGATGGGGCCTGG - Intergenic
902547375 1:17198612-17198634 CTCAGCTCAGAGATGGTGGCTGG + Intergenic
902918853 1:19654960-19654982 CACAGCAAGGTGCAGGGGGCCGG - Intronic
905199398 1:36306223-36306245 CTCACCCCGGGGTTGGGGGCCGG + Intergenic
905616319 1:39402693-39402715 TTCAGCACAGTGATGGGTGTTGG - Intronic
906544879 1:46613772-46613794 CGCAGCATTGTGCTGGGGGCAGG + Intronic
907407525 1:54262795-54262817 CTCTGCAGGGTGATGGCAGCAGG + Intronic
907557586 1:55358220-55358242 ATCAGCCCAGTGAAGGGGGCTGG + Intergenic
907755927 1:57310697-57310719 CTCACTACAGTGATGGGAGCAGG - Intronic
908739728 1:67314834-67314856 CTCAGATCGGGGATGGGGGTGGG - Intronic
910757914 1:90710879-90710901 CTCCGCATGGGGCTGGGGGCTGG + Intergenic
915362738 1:155295557-155295579 CTCAGCATGGTACTGGGGGAGGG + Exonic
915473605 1:156139698-156139720 CTCACCCCGGGGCTGGGGGCAGG - Exonic
917046374 1:170865097-170865119 GTCAGCATTGTGATGAGGGCTGG - Intergenic
917127519 1:171700778-171700800 CACAGCACTGTGCTGGGTGCTGG + Exonic
919887203 1:201943492-201943514 CACAGCACCGTGCTGGGGGCAGG - Intronic
920030506 1:203034757-203034779 CTCATCAGGGTGATGGCAGCCGG - Intronic
921323667 1:213969076-213969098 TTCAGCTCGGTGTTTGGGGCAGG - Intergenic
923689226 1:236176547-236176569 CACAGCCCTGTGCTGGGGGCTGG - Intronic
1066449232 10:35512790-35512812 CTCAGCATGGTGATGGGTGGAGG + Intronic
1068954156 10:62806029-62806051 CCGGGCACGGTTATGGGGGCGGG + Exonic
1069793038 10:71035537-71035559 CGCAGGACTGTGTTGGGGGCAGG - Intergenic
1069967869 10:72136565-72136587 ATCAGCAGGGGGATGTGGGCGGG + Intronic
1070816575 10:79328315-79328337 ATCTGCACGCTGCTGGGGGCAGG - Intergenic
1072088375 10:92102487-92102509 TGCAGCCTGGTGATGGGGGCAGG - Intronic
1072194221 10:93101795-93101817 CTTGGCACGGTGGTGGGTGCTGG - Intergenic
1073112002 10:101067880-101067902 CTCACCACGCTGGTGGGGGCTGG + Intronic
1073112619 10:101071735-101071757 ATCTGCATGGAGATGGGGGCAGG + Intergenic
1073594796 10:104789036-104789058 TTCAGCAGGGTGAGGGGGGCAGG + Intronic
1074237672 10:111602257-111602279 CTCAGCTCTGTGATGGGCTCAGG - Intergenic
1074471784 10:113733859-113733881 CTCAGTACTGTGGTGGTGGCTGG - Intergenic
1075688460 10:124379756-124379778 CCTTGCACGGTGATGGGGGCGGG + Intergenic
1075777356 10:124997405-124997427 TTCAGCAGGGTGGTAGGGGCCGG - Intronic
1075841805 10:125511247-125511269 CTGAGCACCGCGACGGGGGCGGG - Intergenic
1076543321 10:131228021-131228043 CACAGCACGGAGAGGGGGGCTGG - Intronic
1076644492 10:131943281-131943303 CTCAACACAGAGATGGGGGCGGG + Intronic
1076948049 10:133665207-133665229 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1076949039 10:133668517-133668539 GTCAGCCCGGTGGAGGGGGCGGG - Intronic
1076950023 10:133671816-133671838 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1076951007 10:133675115-133675137 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1076951997 10:133678425-133678447 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1076952986 10:133681735-133681757 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1076953970 10:133685034-133685056 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1076954954 10:133741386-133741408 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1076955943 10:133744696-133744718 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1076956933 10:133748006-133748028 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1076957920 10:133751315-133751337 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1076958905 10:133754614-133754636 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1076959894 10:133757924-133757946 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1076960878 10:133761223-133761245 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1077378989 11:2219421-2219443 CTCAGCAAAGCCATGGGGGCAGG - Intergenic
1077911498 11:6575726-6575748 CTAAGCTCGGTGAGGGAGGCAGG - Intronic
1078279064 11:9881309-9881331 TTCAGCACTCTGCTGGGGGCTGG + Intronic
1078781539 11:14443609-14443631 CTCTGGAAGGTGTTGGGGGCGGG - Intronic
1078937489 11:15964620-15964642 CCAAGCACTGTGTTGGGGGCAGG + Intergenic
1079115088 11:17635532-17635554 CACAGCACGTTGCTGGGGGTGGG - Intronic
1081769424 11:45639118-45639140 CTCAGCCAGGGGATGGGGGTAGG + Intergenic
1083769614 11:64859209-64859231 CTCAGCACAGTGCTGGATGCCGG - Intronic
1083959604 11:66007281-66007303 CTCAGCAGGCTGCCGGGGGCAGG - Intergenic
1083988153 11:66230453-66230475 TTCAGGATGGTGATGGGGCCTGG + Intronic
1084113887 11:67030744-67030766 CTCAGCAGGGAGATGGGAGCTGG + Intronic
1084189130 11:67491042-67491064 CGCAGCACGGGCAGGGGGGCTGG - Exonic
1084302657 11:68261635-68261657 CTCAGAAATGTGAGGGGGGCGGG - Exonic
1084491025 11:69478372-69478394 CTCAGCACAGGGGTGGAGGCGGG - Intergenic
1088598441 11:111456468-111456490 CTCAGCCCTGGGCTGGGGGCCGG - Intronic
1089011497 11:115135766-115135788 CTCATCCCTGTGATGGGTGCTGG - Intergenic
1089189671 11:116644731-116644753 TTCAACACGGTCATGTGGGCTGG - Intergenic
1089389269 11:118088953-118088975 CCCACCATGGTGATGGGGTCTGG + Intronic
1090244343 11:125205045-125205067 CTCAGCACGATGCTGGGTTCTGG - Intronic
1091241115 11:134053123-134053145 CTCAGCATGGAGACGGGGGCGGG + Intergenic
1091407885 12:220470-220492 CTCAGCACGGTGATGGGGGCGGG - Intergenic
1092199177 12:6569375-6569397 CTCAGCACAAAGGTGGGGGCAGG - Intergenic
1093136566 12:15459251-15459273 CCCAGGTCTGTGATGGGGGCCGG + Intronic
1093284985 12:17247812-17247834 CTGAGCAAGGTGATGTGAGCTGG + Intergenic
1096071049 12:48775765-48775787 CTCAGCACAGTGTTGGGGTGGGG - Intronic
1097262057 12:57725758-57725780 CCCAACATGGGGATGGGGGCGGG - Intronic
1097983158 12:65754956-65754978 CTCAGGAGGGAGAAGGGGGCGGG + Intergenic
1102030560 12:109737881-109737903 CTCAGAACAGAGATGGGGGAGGG + Intronic
1102689312 12:114747916-114747938 TTCTGCACGGGGATGGGTGCTGG + Intergenic
1102952147 12:117038142-117038164 CTCCTCACGGTGATTGGGGGAGG - Intergenic
1103792766 12:123483379-123483401 CTCAGCATGGTGTTGTGGGGTGG - Intronic
1104542199 12:129676197-129676219 CACATCAAGATGATGGGGGCAGG + Intronic
1106004206 13:25753331-25753353 GTCAGCACTGAGCTGGGGGCTGG - Intronic
1109568284 13:64149378-64149400 CTCAGCACTTTGGTGGGGGCGGG + Intergenic
1110560824 13:76909200-76909222 TTCAGCACAGTTAAGGGGGCAGG - Intergenic
1112760982 13:102692907-102692929 CTCAGCCCTGTGTTGGGAGCTGG - Intronic
1114309125 14:21450505-21450527 CTGAGCACTGTGATATGGGCCGG + Intronic
1116795377 14:49384603-49384625 ATGAGCAGGGTGGTGGGGGCGGG - Intergenic
1118630020 14:67694389-67694411 CTCAGCAGGGTTATGGGAGTCGG - Intronic
1118716550 14:68564086-68564108 CTCTGCCCGGTGTTTGGGGCAGG + Intronic
1118884069 14:69852043-69852065 CCCAGGACGGTGCTGGGGACAGG - Intergenic
1119291468 14:73498603-73498625 CCCAGCAGGGTGATGGGGAAAGG + Intronic
1119584905 14:75824222-75824244 CTCAGCACAGTATTGGGTGCTGG + Intronic
1121270145 14:92632423-92632445 CTCAGCACAGCCCTGGGGGCTGG - Intronic
1121617753 14:95324321-95324343 CTCAGCACGGTGCTGGGCTCTGG - Intergenic
1122285439 14:100649025-100649047 CCCAGCACAGCCATGGGGGCAGG + Intergenic
1122664219 14:103317506-103317528 CTCACCACTCTGATGGGGACAGG + Intergenic
1202848671 14_GL000225v1_random:1954-1976 GTCAGCCCGGTGGAGGGGGCTGG - Intergenic
1202852781 14_GL000225v1_random:31427-31449 GTCAGCCCGGTGGAGGGGGCAGG - Intergenic
1202864055 14_GL000225v1_random:104192-104214 GTCAGCCCGGTGGAGGGGGCGGG + Intergenic
1202922177 14_KI270723v1_random:36030-36052 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1202922756 14_KI270724v1_random:1584-1606 GTCAGCCCGGTGGAGGGGGCGGG + Intergenic
1125162622 15:36663623-36663645 TTCAGCACGATGATGGTGGAAGG - Intronic
1126109663 15:45167886-45167908 CTCAGCCAGGTGATGGGCACAGG + Exonic
1129232376 15:74203897-74203919 CTCAGGATGGGGATGGGGGTGGG + Intronic
1129254846 15:74328416-74328438 CTCAGAAAGGTGAAGGGGCCTGG + Intronic
1129451958 15:75656175-75656197 ATCAGCAGTGTGATGGGGGTGGG + Intronic
1130579631 15:85124447-85124469 CTCAGGATGGTGATAGGAGCTGG - Intronic
1132073746 15:98801822-98801844 CTAGCCACGGGGATGGGGGCTGG - Intronic
1132718090 16:1301968-1301990 CTCAGGACGGAGGTGGTGGCCGG + Intergenic
1132726724 16:1342102-1342124 CTCAGCTTGGTCATGGGGCCCGG + Intronic
1132799829 16:1746578-1746600 TTCAGCACAGTGATGGTGACGGG + Intronic
1132980908 16:2738272-2738294 CCCAGCACGGGGATGGAGGCTGG + Intergenic
1133041785 16:3064856-3064878 CTCAGCTGGGGGAAGGGGGCTGG + Intergenic
1133781132 16:8940369-8940391 CTGAGCACTGTGCTGGAGGCTGG - Intronic
1133854090 16:9533547-9533569 CTCAGCACAGCGAGGGGGTCTGG - Intergenic
1134005231 16:10814592-10814614 CTCAGGGCAGTGATGGAGGCTGG - Intronic
1134090851 16:11390982-11391004 GTCAGCACAGGGAAGGGGGCTGG - Intronic
1134507900 16:14823022-14823044 CTCAGCAGGCTGGTGGCGGCAGG + Intronic
1134695601 16:16221785-16221807 CTCAGCAGGCTGGTGGCGGCAGG + Exonic
1134818751 16:17228468-17228490 CACAGAACGGTGATGGGGTTGGG + Intronic
1134976228 16:18572901-18572923 CTCAGCAGGCTGGTGGCGGCAGG - Intergenic
1136102139 16:28004088-28004110 CACAGCAGGGTGGAGGGGGCAGG + Intronic
1141251415 16:82362457-82362479 CTCAGCACTGTGATAGGTGCTGG + Intergenic
1141445838 16:84057603-84057625 GTCAGCCCAGTGCTGGGGGCAGG - Intronic
1142214229 16:88822896-88822918 CTCAGCATGGTGCAGGGCGCTGG + Intronic
1142481162 17:219033-219055 CACAGCAGGGTGAGGAGGGCAGG - Intronic
1142744132 17:1947369-1947391 CGCTGCAGGGTGAAGGGGGCCGG - Intronic
1145282177 17:21476306-21476328 GGCAGCAGGGTGATGGGGCCTGG + Intergenic
1146454203 17:32996715-32996737 CTGATCAAGGTGATTGGGGCAGG - Intronic
1147581948 17:41631984-41632006 CCGAGCAAGGAGATGGGGGCTGG - Intergenic
1148440018 17:47707180-47707202 CTCAGAACAGTGATGAAGGCAGG + Intronic
1148741046 17:49892879-49892901 CACAGCACAGGGAAGGGGGCAGG + Intergenic
1150720745 17:67612265-67612287 CTCCACAGGGTCATGGGGGCAGG + Intronic
1151756784 17:76079808-76079830 CTCAGCATGTTGATGAAGGCTGG - Intronic
1151876482 17:76870178-76870200 CTCCAGACGGGGATGGGGGCGGG + Intronic
1152572665 17:81127434-81127456 CTCTGGAAGGTGGTGGGGGCAGG + Intronic
1152794774 17:82301567-82301589 CTCATCAGGGTGTTGAGGGCAGG + Intergenic
1152878122 17:82800010-82800032 CAGAGCAGGGGGATGGGGGCTGG - Intronic
1152965794 18:112312-112334 GTCAGCCCGGTGGAGGGGGCGGG + Intergenic
1154978394 18:21481224-21481246 CTGGGCAGGGGGATGGGGGCAGG + Intronic
1155268441 18:24116433-24116455 CTCAGCAGGCTGAGGCGGGCGGG + Intronic
1156084205 18:33379652-33379674 CTCCGCAAGGTGATGGAGGGTGG + Intronic
1156487956 18:37478540-37478562 CTCAGGACAGTGGTTGGGGCAGG + Intronic
1157275127 18:46304856-46304878 CTCTCCCCGGGGATGGGGGCAGG + Intergenic
1157512976 18:48291743-48291765 GTCACCATGGTGATGGTGGCAGG + Intronic
1158648023 18:59264745-59264767 CTCAGGAGGGTGATCCGGGCTGG - Intergenic
1161608116 19:5225898-5225920 CTCAGCACGGGGAGTGGGGGTGG - Intronic
1161620281 19:5293689-5293711 GGAGGCACGGTGATGGGGGCGGG + Intronic
1162079465 19:8209610-8209632 CCCGGCGGGGTGATGGGGGCTGG - Intronic
1163623520 19:18374640-18374662 CTGAGCACGGGGGTGGGGGCGGG + Intergenic
1164002265 19:21112963-21112985 CCCAGCATGGTGGTGGGTGCTGG - Intronic
1164432056 19:28197290-28197312 CTCTGCACAGGGATGGGGTCAGG + Intergenic
1164455457 19:28403104-28403126 CTCAGCGTGGTGATGTGTGCCGG - Intergenic
1164730533 19:30500731-30500753 CTCAGCAGGATGATGTGGGATGG + Intronic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
1166322558 19:42027639-42027661 CCCATCACAGTGCTGGGGGCAGG + Intronic
1166752855 19:45172944-45172966 CTCAGGACGGTGTTCCGGGCAGG + Intronic
1166792053 19:45404446-45404468 TTCGGCTCGGGGATGGGGGCGGG - Intronic
1166831855 19:45643994-45644016 CTCAGCCCGTAGGTGGGGGCTGG + Intronic
1167492793 19:49801872-49801894 CTCACCACAGTGCTGGGGGTGGG - Exonic
1167643328 19:50693719-50693741 CTCAGCATGGGGAGGGGGGCTGG - Intronic
924985200 2:264243-264265 CCAAGCACGGTGTTGGGGGTGGG + Intronic
925671595 2:6315600-6315622 GTCAGCACGCAGATGGGAGCAGG + Intergenic
926090181 2:10044150-10044172 CGCGGCACGGTTTTGGGGGCGGG + Intronic
926311624 2:11679785-11679807 CTCTGAAGGGTGATGGGGGCCGG + Intronic
927222372 2:20725207-20725229 TTCAGCACCATGATGGGGGGTGG + Intronic
927884405 2:26709797-26709819 CCCAGCAAGGCGATGGGCGCAGG + Intronic
929753498 2:44742093-44742115 CTCAGGGCTGTGATGAGGGCTGG + Intronic
932757993 2:74422008-74422030 CAGAGGACGGTGATGGGGGAGGG - Intronic
933750754 2:85601071-85601093 CTCAGCAGGGTCAGGAGGGCAGG + Exonic
936088770 2:109487860-109487882 CTCAGCACCGTGCTAGGCGCTGG + Intronic
936574768 2:113643900-113643922 CTCAGAAGAGTGAGGGGGGCAGG + Intergenic
938200273 2:129367005-129367027 CTCAGCAAGGTGGTGGGTGAAGG + Intergenic
940052730 2:149480873-149480895 CTGAGGTAGGTGATGGGGGCTGG - Intergenic
940909410 2:159196785-159196807 CACAGCTCGGTGAGTGGGGCAGG + Exonic
944194065 2:197033615-197033637 AACAGCACAGGGATGGGGGCAGG + Intronic
945058385 2:205887827-205887849 CTCAGCACGGTGCTGGCAGGTGG + Intergenic
945438979 2:209855295-209855317 GTCAGCAGGGTTAGGGGGGCAGG + Intronic
945866519 2:215182378-215182400 CTGAGCACTCTGACGGGGGCAGG - Intergenic
948372851 2:237501204-237501226 GTCAGTACTGTGCTGGGGGCTGG - Intronic
948450347 2:238066444-238066466 CTCAGCACCCTGTTGGGGGAGGG + Intronic
1169009258 20:2236691-2236713 CTGCGCAGGGAGATGGGGGCCGG + Intergenic
1171091600 20:22290666-22290688 TTCAGCATGCAGATGGGGGCAGG - Intergenic
1172276068 20:33680057-33680079 GGCAGCAGGATGATGGGGGCTGG + Intronic
1175221619 20:57420656-57420678 AGCAGCAGGGTGCTGGGGGCGGG + Intergenic
1175271406 20:57736634-57736656 CTGAGCATGCTGATGGGGGTGGG + Intergenic
1175273037 20:57748318-57748340 CTCATCAGGGAAATGGGGGCAGG + Intergenic
1176207247 20:63895566-63895588 CTGAGCACCGTGGTGGGGGCTGG + Intronic
1176521720 21:7829625-7829647 CGCTGCACAGGGATGGGGGCGGG + Intronic
1177862699 21:26473563-26473585 CTGAGCACAGTGAAGGGGGTGGG - Intronic
1178655740 21:34459637-34459659 CGCTGCACAGGGATGGGGGCGGG + Intergenic
1179153916 21:38832989-38833011 CCCAACACTGTGATGGGGGCCGG + Intergenic
1179174683 21:38999892-38999914 CTCAGCACAGTGGTGGAGACTGG - Intergenic
1179925911 21:44533943-44533965 CTCAGGACGGGGCTGGGGGTAGG + Intronic
1179980491 21:44893251-44893273 CCCAGCACTCTGACGGGGGCAGG - Intronic
1179984108 21:44911779-44911801 CTCAGCCTGGTGCTGGAGGCCGG + Intronic
1180701498 22:17783757-17783779 CTCTGCAGGGTTCTGGGGGCCGG + Intergenic
1181573930 22:23782270-23782292 CCCAGCTCGGTGAGGGGTGCGGG - Exonic
1183608604 22:38882422-38882444 CTCAGCATGGTGGCTGGGGCAGG + Intergenic
1183862424 22:40679613-40679635 CTCAGCTCGGTTGTGGGAGCAGG + Exonic
1184742957 22:46439710-46439732 CTCAGAACGGGGTTGGAGGCTGG - Intronic
1184898283 22:47425174-47425196 CTCAGAAAGGCGGTGGGGGCAGG - Intergenic
1185425405 22:50766976-50766998 CTCAGAAGAGTGAGGGGGGCAGG - Intergenic
950232682 3:11290336-11290358 CCCAGCGCGGTGATGGAGGAGGG + Intronic
953843356 3:46407322-46407344 CTGAGCTCGGTGAGTGGGGCGGG + Intronic
954194864 3:48990534-48990556 CTGGGCACGGTGTTGGGGCCCGG - Exonic
954414623 3:50387155-50387177 CTCAGCACAGGGAAGGGAGCTGG + Intronic
957729231 3:84110979-84111001 GACAGCACAGTGATGGGGGGTGG + Intergenic
961573644 3:127817903-127817925 ATCAGCACGGCGATGGAGACTGG - Intronic
961830728 3:129621761-129621783 TTCAGCCCGGTGCTGGGTGCTGG + Intergenic
962976616 3:140451500-140451522 CTCAGCAGGGTTATTGGGACAGG - Intronic
965405291 3:168260659-168260681 CTCAGGAAGGTGATCTGGGCTGG + Intergenic
965608896 3:170524392-170524414 ATGAGCACTGTGATGGGGGTAGG + Intronic
965619621 3:170629730-170629752 CTAATCACGGGTATGGGGGCTGG + Intronic
965836550 3:172859857-172859879 GTCAGCAAGATGATGGGGCCAGG - Intergenic
966246042 3:177809005-177809027 CTGGGCACGGGGGTGGGGGCGGG + Intergenic
968427600 4:534000-534022 GTCAGCACAGTTCTGGGGGCCGG + Intronic
968529397 4:1082751-1082773 CTCAGCACTGTTCTGGGGGCTGG - Intronic
968600450 4:1506244-1506266 CACAGCACGTTCATGGGGGAGGG - Intergenic
969056818 4:4407483-4407505 CTCAGCACAGTGCCCGGGGCAGG - Intronic
969593293 4:8133856-8133878 CTCAGGACTGTGGTGTGGGCAGG - Intronic
969608042 4:8212012-8212034 CTCAGAACCACGATGGGGGCAGG + Intronic
973142207 4:46782500-46782522 ATCAGCAGGATGTTGGGGGCGGG + Intronic
979140258 4:117163205-117163227 TCCAGGAAGGTGATGGGGGCTGG - Intergenic
980530446 4:134046185-134046207 CTCAGCAAGGGGAATGGGGCAGG + Intergenic
981449857 4:144884374-144884396 CTCAGCACCATGCTGGGAGCTGG + Intergenic
982206458 4:153000696-153000718 CTCAACAGGGTGATGGGGGTGGG + Intergenic
985451505 4:190066014-190066036 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
985452495 4:190069307-190069329 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
985453480 4:190072604-190072626 GTCAGCCCGGTGGAGGGGGCGGG - Intronic
985454470 4:190075897-190075919 GTCAGCCCGGTGGAGGGGGCGGG - Intronic
985455458 4:190079190-190079212 GTCAGCCCGGTGGAGGGGGCGGG - Intronic
985456443 4:190082484-190082506 GTCAGCCCGGTGGAGGGGGCGGG - Intronic
985457430 4:190085784-190085806 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
985458417 4:190089077-190089099 GTCAGCCCGGTGGAGGGGGCGGG - Intronic
985459406 4:190092377-190092399 GTCAGCCCGGTGGAGGGGGCGGG - Intronic
985463658 4:190175146-190175168 GTCAGCCCGGTGGAGGGGGCGGG - Exonic
985541850 5:491088-491110 CTCAGACCGGTGAGGGCGGCAGG + Intronic
985674473 5:1223893-1223915 GTCAGCAGGGTGAAAGGGGCTGG - Exonic
985998279 5:3609785-3609807 CTCAGCACGGTGTTGGGATGGGG + Intergenic
994926898 5:106127360-106127382 ATCTGCAAGGTGTTGGGGGCTGG + Intergenic
997742662 5:136270798-136270820 CTCAGCAGGGTGACAGGTGCTGG + Intronic
998202650 5:140137499-140137521 CTCATCTCAGAGATGGGGGCAGG + Intergenic
1000014823 5:157267011-157267033 CTCTGCTTGGGGATGGGGGCAGG + Intronic
1002137135 5:177114679-177114701 CACTGCCCAGTGATGGGGGCGGG - Intergenic
1002437688 5:179242021-179242043 CTCAGCACAGTGATTGGTCCAGG + Intronic
1003668148 6:8130720-8130742 CTCAGCACTGTGCTGGGTGCCGG - Intergenic
1004562568 6:16763345-16763367 CCAAGCAGGGTGTTGGGGGCGGG - Intergenic
1006864726 6:37200255-37200277 CTCAGCACAGCAGTGGGGGCTGG + Intergenic
1007162838 6:39806109-39806131 CTCAGCAATGTCATGGGGGAAGG + Intronic
1007217625 6:40252634-40252656 CTCATCACTGTGATGCTGGCAGG + Intergenic
1007315342 6:40983787-40983809 CTCTGGACTGGGATGGGGGCAGG - Intergenic
1007655823 6:43450529-43450551 CACAGCACTGTGATGGAGGTGGG - Exonic
1011010953 6:82703622-82703644 CTCAGAACTGTGATGGGTGTTGG + Intergenic
1012640560 6:101606438-101606460 CTCAGCATTGTGCTGGGCGCTGG + Intronic
1014272475 6:119349590-119349612 CTCAGCGCGGAGATGGGGAGCGG - Exonic
1016841251 6:148527783-148527805 CTCAGCACCGTGCTTGGTGCTGG + Intronic
1016879799 6:148899894-148899916 CACAGAAGGGTGATGGGGGGTGG - Intronic
1019334591 7:476997-477019 CTCAGCAATGTCCTGGGGGCAGG - Intergenic
1020449729 7:8307237-8307259 CTAAGCACGTTAATGAGGGCGGG - Intergenic
1021621341 7:22553447-22553469 CTGAGCACAGTGATGGGGATTGG - Intronic
1023092241 7:36628095-36628117 CTCAGCTTGGAGGTGGGGGCAGG + Intronic
1023352333 7:39333109-39333131 CTCAGCAAAGTGTTGGGGGCGGG - Intronic
1023921264 7:44631989-44632011 CTCAGCAGGATGATGGATGCAGG + Intronic
1024312153 7:47979368-47979390 ATCAGAACGGGGATGGGCGCCGG - Intronic
1024461842 7:49667547-49667569 TTCAGCACTGTGCTAGGGGCTGG - Intergenic
1032076284 7:128837669-128837691 GTCTGCACGGTGAAGTGGGCAGG - Exonic
1033545315 7:142394313-142394335 TTCAGGACGGAGATGGGAGCAGG - Intergenic
1035019894 7:155794574-155794596 CTCAGGAGGGGGGTGGGGGCAGG + Intergenic
1035028493 7:155842684-155842706 GTCAGCACTGAGATGGGGGCAGG + Intergenic
1035227313 7:157440859-157440881 CACAACATGATGATGGGGGCAGG + Intergenic
1035690576 8:1557027-1557049 CTCAGCACGGGGGTGGGGGCTGG + Intronic
1036185074 8:6615492-6615514 CTCAGCCCTGAGTTGGGGGCAGG + Intronic
1036442963 8:8797561-8797583 CACTGCCCGGGGATGGGGGCAGG + Intronic
1037628271 8:20627820-20627842 CTCAGCAGGGATATGGGTGCTGG + Intergenic
1039891985 8:41692026-41692048 CTGAGTATGGTGGTGGGGGCAGG - Intronic
1041152036 8:54944795-54944817 CCCAGCAAGGTGATAGTGGCAGG - Intergenic
1041392123 8:57356293-57356315 CTCAGCTGTGAGATGGGGGCAGG - Intergenic
1047587985 8:126294787-126294809 CTCAGCGTGATGATGGTGGCTGG - Intergenic
1048127875 8:131657170-131657192 CTCAGCCCAGTTATGGGGTCTGG - Intergenic
1048587012 8:135783560-135783582 CACAGACCGGTAATGGGGGCTGG + Intergenic
1049037413 8:140087257-140087279 ATCTGCAGGGTGATGGGGCCGGG - Intronic
1049358721 8:142201680-142201702 CACAGCAGGGAGAGGGGGGCCGG + Intergenic
1049758894 8:144322979-144323001 CCCAGCACCGTGACGGGAGCAGG + Intronic
1049774936 8:144399857-144399879 GTCAGCACGTAGCTGGGGGCAGG + Exonic
1049787434 8:144457703-144457725 CTCAGCCAGGGGATGGGGTCAGG - Intronic
1052437119 9:28443787-28443809 AACAGCACGTTGATGGTGGCAGG + Intronic
1052834881 9:33242850-33242872 CAGAGCACTGGGATGGGGGCAGG - Intronic
1056733611 9:89185817-89185839 CTCACCACAGTGTTGGGGGGTGG + Intergenic
1057873639 9:98736425-98736447 CACAGCAGTGTGACGGGGGCAGG + Exonic
1058890036 9:109353816-109353838 CTCAGCAAGGTGGCGGGGGCTGG - Intergenic
1060159825 9:121351470-121351492 CTCAGCATGGTGATGGAGCCTGG - Intronic
1061681339 9:132243870-132243892 GTCAGCAGGGTGCTGGGGGTGGG - Exonic
1061703495 9:132434214-132434236 CTCAGAGCGGGGATGGGGTCTGG - Intronic
1061886510 9:133593719-133593741 CACAGCCCGGTGCTGGGGCCAGG + Intergenic
1203740264 Un_GL000216v2:171824-171846 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1185525009 X:771660-771682 CTCAGCAAGGGGCTGGGGCCAGG + Intergenic
1187045765 X:15646650-15646672 CTCAGGACGCGGATGCGGGCGGG - Intronic
1187051764 X:15703019-15703041 CTCAGGACGCGGATGCGGGCGGG - Intronic
1187276017 X:17817195-17817217 CTGTGCACAGTGCTGGGGGCAGG + Intronic
1188635455 X:32425219-32425241 CTCTGCACGGTAAAGGGGGTTGG - Intronic
1189238186 X:39505098-39505120 CTCAGCACGGGGTGGAGGGCTGG + Intergenic
1189483648 X:41412314-41412336 CTAAGCATGGGGGTGGGGGCAGG + Intergenic
1189880577 X:45487249-45487271 CCCAGCAAAGTGATGGGGGTGGG + Intergenic
1190736138 X:53256833-53256855 CTCAGCTGGGGGAAGGGGGCAGG + Intronic
1191668314 X:63725615-63725637 CTAAGCACGGTGATAGGGATGGG + Intronic
1192566227 X:72165970-72165992 CTCAGGACAGTGGTTGGGGCTGG - Intergenic
1199769638 X:150966342-150966364 CTAAGCACGGATATGGGGGCCGG + Intergenic
1201179913 Y:11333693-11333715 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic